Calisto pulchella

Lathy, 1899 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Calisto

At a glance

Occurrence records93

Data sources7

Biological traits0

DNA specimens26

eDNA detections29

Sources7 archives

Databases and archives Calisto pulchella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility93 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF93 records

Environmental DNA1 datasets · 1 countries29 detections

DNA & barcodingBOLD26 specimens

01Narrative

Calisto pulchella is a butterfly of the family Nymphalidae. Described by Percy Ireland Lathy in 1899, it is endemic to Hispaniola. The larvae are a pest on sugarcane, but the native host plant is unknown."Darwin's butterflies"? DNA barcoding and the radiation of the endemic Caribbean butterfly genus Calisto (Lepidoptera, Nymphalidae, Satyrinae)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calisto pulchella has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections29

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

103Cmostly conserved

235Cmostly conserved

340Tmostly conserved

368Gvariable

385Tmostly conserved

388Avariable

403Tmostly conserved

454Amostly conserved

536Tmostly conserved

565Amostly conserved

628Amostly conserved

TACTTTATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGAACATCCCTCAGTATTATTATTCGTATAGAATTAGGAAATCCAGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes8

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calisto zangissame genus8.4%Calisto raburnisame genus8.4%Calisto herophilesame genus8.7%Calisto archebatessame genus9.0%Calisto tragiussame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type93 records

Wild obs. + sensor32

Museum / vouchered61

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 9≤1 km 12≤10 km 2>10 km 2

25 georeferenced · 7 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 2≤1 km 12≤10 km 15>10 km 30

59 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	46
MZLUlocation not on record	11
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
New Haven, US	1
King Saud Universitylocation not on record	1

5 institutions · 61 of 61 vouchered records shown

09Environmental DNA29 detections

Where the DNA of Calisto pulchella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 17.5–17.5

Seasonal swing summer↔winter3.20 °C

Max temp (day)21.1 °C

Min temp (night)14.0 °C

Precipitation130 mm/mo

Air humidity70.7 %

Moisture balance39.3 mm/mo

Vapour deficit584 Pa

Wind speed2.10 m/s

Cloud cover26.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)