Calendula suffruticosa

Vahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Calendula

At a glance

Occurrence records650

Data sources10

Biological traits31

DNA specimens9

eDNA detections17

Sources10 archives

Databases and archives Calendula suffruticosa's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility650 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources31 traits

Occurrence & distributionGBIF650 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Calendula suffruticosa is a species of herb in the family Asteraceae. It has a self-supporting growth form and broad leaves. Individuals can grow up to 40 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.4 m

Plant height max0.6 m

Plant height min0.15 m

Seed mass1.45 mg

Life cycle & reproduction15

Dehiscenceindehiscent

Dispersal typeunspecialized

Flower colouryellow

Flower width max45 mm

Flower width min35 mm

Flowering endDec

Flowering startNov

Life formsubshrub

Life spanperennial

Lifespan years5 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Self fertilizationabsent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: herb

Leaf formelliptic

Woodinessnon-woody

Other traits3

Leaf arrangementalternate

Seeds per fruit101-1000

Shoot orientationerect

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calendula suffruticosa has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences10

eDNA detections17

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKM356158.1 ↗629 bp

ACGT

CATTGTCGAACCCTGCACAGCAGAATGACCCGTGAACATGTACTAACAACCGGGCGTCGTTTGGAGGGTCTCGTTTCCTGTCCTTGCGCC …

Calendula suffruticosa isolate Cal15-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Calendula suffruticosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records18–322n range32median32mode27records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3216×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +6

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).

CCDB · fl-europaea — Femandes & Queiros

CCDB · fl-europaea — Meusel & Ohle, 1966

CCDB · ipcn-api-dl — Rizzotto, M. 2002. Calendula suffruticosa Vahl subsp. fulgida (Raf.) Ohle (Asteraceae) in the island of Gorgona (Tuscan Archipelago, Italy). Webbia 57(2): 187–191.

CCDB · book-ipcn66 — Meusel &Ohle 1966

CCDB · book-ipcn73-74 — OHLE, H. 1974. Sudeuropaische perennierende Calendula-Sippen. Feddes Rep. 85: 245-283.

CCDB · book-indian_vol1 — Weddle, C.1941

CCDB · book-fedorov — Meuse!, Ohle 1966

CCDB · book-fedorov — Weddle 1941

CCDB · book-atlas-flowering-plants

CCDB · kew — Nora S, Castro S, Loureiro J, Gonçalves AC, Oliveria H, Castro M, Santos C, Silveira P. 2013. Flow cytometric and karyological analyses of Calendula species from Iberian Peninsula. Plant Systematics and Evolution. doi: 10.1007/s00606-013-0767-0

2n 288×CCDB · iber-fl · CCDB · book-indian_vol1 · CCDB · book-fedorov +2

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · book-indian_vol1 — Negodi, G. 1935, 1937a ; Delay, C. 1947 ; Janaki Ammal, E.K. & Sobti, S.. N. 1962

CCDB · book-fedorov — Negodi 1937a

CCDB · book-fedorov — Negodi 1935, 1937a

CCDB · book-fedorov — Delay 1947

CCDB · book-fedorov — Janaki Ammal, Sobti 1962

CCDB · book-atlas-flowering-plants — Negodi 1936a

CCDB · Cave1962 — Janaki Ammal 1962a

2n 183×CCDB · book-ipcn66 · CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-ipcn66 — Meusel &Ohle 1966

CCDB · book-indian_vol1 — Meuse!, H. & Ohle, H. 1966

CCDB · book-fedorov — Meuse!, Ohle 1966

n 166×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — MEUSEL H., OHLE H. - 1966. Zur Taxonomie und Cytologie der Gattung Calendula.. Oesterr. Bot. Z. , 113: 191-210.

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 99-103. Talavera, S.Lagascalia9(1): 122-123(1979).

CCDB · ipcn-api-dl — Talavera, S. 1979a. In Numeros cromosomicos para la flora Espanola. 84-120. Lagascalia 115–130.

CCDB · ipcn-api-dl — Aparicio Martínez, A. 1989. Números cromosomáticos de plantas occidentales, 487--507. Anales Jard. Bot. Madrid 45: 483–494.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type650 records

Wild obs. + sensor537

Museum / vouchered112

Other1

Origin

Native5

Range

Area of Occupancy AOO1 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 165≤1 km 53≤10 km 66>10 km 16

300 georeferenced · 237 without coordinates

Open the mapobservation + sensor537

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 12≤1 km 31≤10 km 7

50 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	24
AVElocation not on record	13
CICYTEXlocation not on record	12
BClocation not on record	11
València, ES	8
Wlocation not on record	7
Paris, FR	6
College of the Atlantic, Museumlocation not on record	5
Oskarshamn, SE	3
MAlocation not on record	3
Sevilla, ES	3
Granada, ES	2
Phyletisches Museum Jenalocation not on record	1
Stockholm, SE	1
San Sebastián, ES	1
Salamanca, ES	1
Saint Louis, US	1
Badajoz, ES	1
Vitoria, ES	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

20 institutions · 105 of 112 vouchered records shown · 6 without an institution code

09Environmental DNA17 detections

Where the DNA of Calendula suffruticosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C

Min temp (night)10.4 °C

Precipitation70.4 mm/mo

Air humidity57.7 %

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa

Wind speed2.90 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)