Calendula stellata

Cav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Calendula

At a glance

Occurrence records239

Data sources10

Biological traits4

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Calendula stellata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT1 Gbp

01Narrative

البكورية النجمية نوع نباتي يتبع جنس البكورية من الفصيلة النجمية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formannual

Habitat & environment3

Climatesubtropical

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calendula stellata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences6

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM356154.1 ↗658 bpMorocco

ACGT

CAGAATGACCCGTGAACATGTACTAACAACCGGGCGTCGTTTGGACGGGGCTCGTTTCCTGTCCTCGTGGCGCCCTGTCGGTGTGCGTGC …

Calendula stellata isolate Cal129 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Calendula stellata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 002 449 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calendula stellata1 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–142n range14median14mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 147×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1993. Chromosome numbers of north African phanerogams. II. Willdenowia 23: 211–238.

CCDB · ipcn-api-dl — Vogt, R. & C. Oberprieler. 1994. Chromosome numbers of North African phanerogams. IV. Candollea 49(2): 549–570.

CCDB · ipcn-api-dl — Ohle, H. 1975. Beitrage zur Taxonomie und Evolution der Gattung Calendula L. III. Revision der marokkanischen perennierenden Sippen unter Beruchtichtigung einiger marokkanischer Annueller. Feddes Repert. 86: 1–17.

CCDB · ipcn-api-dl — Heyn, C., O. DAGAN & B. NACHMAN. 1974. The annual Calendula species: Taxonomy and relationships. Israel J. Bot. 23: 169–201.

CCDB · book-ipcn75-78 — Humphries 1978

n 75×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Aparicio Martínez, A. 1989. Números cromosomáticos de plantas occidentales, 487--507. Anales Jard. Bot. Madrid 45: 483–494.

CCDB · ipcn-api-dl — Talavera, S., J. A. Devesa & E. F. Galiano. 1984. Notas cariosistemáticas sobre plantas norteafricanas. I. Compositae. Candollea 39: 271–280.

CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1991. Notas cariológicas sobre algunas especies norteafricanas. Acta Bot. Malac. 16: 449–454.

CCDB · ipcn-api-dl — Diosdado, J. C., F. Ojeda & J. Pastor. 1993. IOPB chromosome data 5. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 20: 6–7.

CCDB · book-ipcn75-78 — Humphries 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type239 records

Wild obs. + sensor178

Museum / vouchered59

Other2

Origin

Introduced2

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 59≤1 km 26≤10 km 49>10 km 5

139 georeferenced · 39 without coordinates

Open the mapobservation + sensor178

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 9≤1 km 4≤10 km 12>10 km 5

30 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sevilla, ES	14
AVElocation not on record	14
BClocation not on record	11
Barcelona, ES	3
Bronx, US	3
MAlocation not on record	3
Phyletisches Museum Jenalocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Paris, FR	1
Oskarshamn, SE	1
College of the Atlantic, Museumlocation not on record	1
Wlocation not on record	1
BIO-UNIPIlocation not on record	1
LDlocation not on record	1

14 institutions · 58 of 59 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Calendula stellata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)