Calendula officinalis
speciesAt a glance
Occurrence records42 555
Data sources14
Biological traits62
DNA specimens37
eDNA detections22
Sources14 archives
Databases and archives Calendula officinalis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility42 555 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources62 traits
Chemical compositionLOTUS · NPASS201 compounds
Occurrence & distributionGBIF42 555 records
Environmental DNA1 datasets · 6 countries22 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB · GoaT · NCBI1.5 Gbp
01Narrative
Le souci ou souci officinal, Calendula officinalis, est une espèce de plantes à fleurs de la famille des Asteraceae. Très commun dans les régions méditerranéennes, le souci officinal croît dans la plupart des jardins et des friches sans avoir besoin d'y être semé, le vent faisant office de jardinier. Ses graines survivent à des froids intenses. Le souci des champs (Calendula arvensis), ou souci sauvage, ou souci des vignes, est plus petit avec des graines du centre un peu différentes. Ses parties ont les mêmes propriétés que le souci officinal. Il est parfois appelé le souci des jardins. Le souci est une plante tinctoriale, d'utilisation domestique. Il fournit une couleur jaune crème, obtenue par une décoction de ses fleurs. Le souci fournit aussi une source de colorant alimentaire non toxique, notamment utilisé pour foncer les beurres. C'est également une plante comestible.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology15
Fruit length25 mm
⚠ sources differ — AusTraits: 25 mm · GIFT: 6 mm
Leaf length80 mm
⚠ sources differ — AusTraits: 80 mm · GIFT: 100 mm
Leaf length max150 mm
Leaf length min50 mm
Leaf size1 773 mm²
Leaf width20 mm
Leaf width max30 mm
Leaf width min10 mm
Plant height0.383 m
⚠ sources differ — GIFT: 0.383 m · AusTraits: 0.5 m · LEDA: 0.325 m · TRY: 0.344 m
Plant height generative0.375 m
Plant height max0.75 m
Plant height min0.15 m
Seed mass3.3 mg
⚠ sources differ — TRY: 3.3 mg · LEDA: 4.12 mg · GIFT: 4.44 mg
Seed mass max16.32 mg
Seed mass min2.2 mg
Life cycle & reproduction21
Deciduousnessalways persistent green
⚠ sources differ — TRY: always persistent green · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeself
⚠ sources differ — LEDA: chamaechor · GIFT: anemochorous
Flower colourorange
Flower length max25 mm
Flower length min15 mm
Flower width max55 mm
Flower width min40 mm
Flowering endSep
Flowering startJan
Flowering timennnnnnnnnnnn
Life formannual or biennial
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTroadsides
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate oblanceolate oblong spathulate
Mycorrhizaabsent
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)89.05 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)20.07 mm²/mg
Other traits5
Diaspore typegenerative dispersule
Leaf arrangementalternate
Plant support typefree-standing
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition201 compounds
Compounds documented for Calendula officinalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Oleanane triterpenoids64
Flavonols38
Ursane and Taraxastane triterpenoids17
Aminoacids14
Carotenoids (C40, Ψ-Ψ)13
Documented compounds201 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((2R,3S,4S,5R,6S)-6-(5,7-Dihydroxy-2-(4-Hydroxy-3-Methoxyphenyl)-4-Oxochromen-3-Yl)Oxy-3,4,5-Trihydroxyoxan-2-Yl)Methyl (E)-3-(4-Hydroxyphenyl)Prop-2-Enoate | present | NPASS | |
| (+)-gamma-Tocopherol | present | LOTUS | |
| (+)-Valine | present | LOTUS | |
| (-)-Caryophyllene | present | LOTUS | |
| (10E,12E,14E)-2,6,10,14,19,23,27,31-octamethyldotriaconta-2,6,10,12,14,16,18,22,26,30-decaene | present | LOTUS | |
| (1R)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(4R)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol | present | LOTUS | |
| (1R)-4-[(1E,3E,5E,7E,9E,11E,13E,15Z,17E,19Z)-3,7,12,16,20,24-hexamethylpentacosa-1,3,5,7,9,11,13,15,17,19,23-undecaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol | present | LOTUS | |
| (1R,2S,3R,4aS,5S,6aR,6aS,6bR,8aR,10R,12aR,14bS)-1,2,4a,6a,6b,9,9,12a-octamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-3,5,10-triol | present | LOTUS | |
| (1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13R,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-9,13-diol | present | LOTUS | |
| (2R)-2-azaniumyl-3-phenylpropanoate | present | LOTUS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calendula officinalis has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes6
GenBank sequences10
eDNA detections22
Countries6
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCCCCCCACCACACATCCCTTTTGGCGATGCCTGGTGCGGGGGCGGAGATTGGCCTCCCGTTCCAATGGCGCGGTTGGC …
Calendula officinalis voucher MX-5 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Calendula officinalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 515 900 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Calendula officinalis1.52 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidy4× tetraploid · measured
Chromosome records28–322n range32median32mode31records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3223×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · poland +8
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · poland — Pogan E., Jankun A., Sawicka Z. et al. 1989. Further studies in chromosome numbers of Polish Angiosperms. Part XXII. Acta Biol. Cracov. Ser. Bot. 31, 1-17.
CCDB · ipcn-api-dl — CZAPIK, R. 1989. Further studies in chromosome numbers of Polish angiosperms. Part XXII. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Baltisberger, M. & W. Huber. 1987. Chromosome number report. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 9: 4–5.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & Z. Sawicka. 1990. Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Murín, A. 1997. Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75–88.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & S. A. Shatalova. 2001. Chromosome numbers in some plant species from the environs of Vladivostok city (Primorsky Region). Bot. Žhurn. (Moscow & Leningrad) 86(1): 168–172.
CCDB · book-ipcn66 — Meusel &Ohle 1966
CCDB · book-ipcn72 — HAZRA, R.R. 1970. Chromosome studies in Calendula. Bull. Bot. Soc. Bengal 24: 95-100.
CCDB · book-indian_vol1 — Weddle, C. 1941; Janaki Ammal, E.K. & Sobti, S.N. 1962 ; Mehra, P.N. et al. 1965 ; Meuse!, H. & Ohle, H. 1966 ; Gupta, P.K. 1969b ; Gupta, P.K. et al. 1972 ; Hazra, R.R. 1970 ; Mehra, P.N. & Remanandan, P. 1976
CCDB · book-fedorov — Weddle 1941
CCDB · book-fedorov — Janaki Ammal, Sobti 1962
CCDB · book-fedorov — Mehra P. N. et al. 1965
CCDB · book-fedorov — Meuse!, Ohle 1966 1962
CCDB · book-fedorov — JI.
CCDB · book-atlas-flowering-plants
CCDB · Cave1962 — Janaki Ammal 1962a
CCDB · CromoCat 2015 — Chen, R. y., Song, W. q., Li, X. l., Li, M. x., Liang, G. l. & Chen, C. b. (2003). Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press Beijing.
CCDB · CromoCat 2015 — Probatova, N. S., E. G. Rudyka & S. A. Shatalova. (2001). Chromosome numbers in some plant species from the environs of Vladivostok city (Primorsky Region). Bot. Žhurn. 86(1): 168–172.
CCDB · CromoCat 2015 — Murín, A. (1997). Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75-88.
2n 288×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +3
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Vachova, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · book-indian_vol1 — Lundegardh, H. 1909 ; Negodi, G. 1935, 1937a
CCDB · book-fedorov — Lundeglirdh 1909
CCDB · book-fedorov — Negodi 1935, 1937a
CCDB · book-atlas-flowering-plants — 1936
CCDB · CromoCat 2015 — Murín, A. (1993). Karyologické štúdium okrasnych rastlín flóry Slovenska. Biologia 48: 441-445.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mathew, A. & Mathew, P. M. (1988). Cytological studies on the south Indian Compositae Glimpses Pl. Res. 8: 1-177.
n 167×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Mehra, P. N. & P. REMANANDAN. 1976. Cytological investigations on Indian Compositae V. Tribes: Arctotideae, Cynareae, Calenduleae and Mutiseae. Nucleus 19: 8–12.
CCDB · book-ipcn67-71 — GUPTA, P.K. 1969. Cytological investigations in some Indian Composi Cytologia 34: 429-438.
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1989). Cytopalynology of north and central Indian Compositae J. Cytol. Genet. 24: 96-105.
CCDB · CromoCat 2015 — Mathew, A. & Mathew, P. M. (1988). Cytological studies on the south Indian Compositae Glimpses Pl. Res. 8: 1-177.
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chen, R. y., Song, W. q., Li, X. l., Li, M. x., Liang, G. l. & Chen, C. b. (2003). Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press Beijing.
CCDB · CromoCat 2015 — Probatova, N. S., E. G. Rudyka & S. A. Shatalova. (2001). Chromosome numbers in some plant species from the environs of Vladivostok city (Primorsky Region). Bot. Žhurn. 86(1): 168–172.
n 71×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Carr, G. D., King, R. M., Powell, A. M. & Robinson, H. (1999). Chromosome numbers in Compositae. XVIII Amer. J. Bot. 86: 1003-1013.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type42 555 records
Wild obs. + sensor40 378
Museum / vouchered1 958
Cultivated / captive46
Other173
Origin
Native146
Introduced2 538
Range
Area of Occupancy AOO93 764 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy65% within 1 km
≤100 m 16 377≤1 km 5 967≤10 km 11 772>10 km 291
34 407 georeferenced · 5 971 without coordinates
Open the mapobservation + sensor40 378
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 233≤1 km 279≤10 km 314>10 km 58
884 georeferenced · 1 074 without coordinates
Open the institutions mapphysical evidence1 958
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy8% within 1 km
≤1 km 3≤10 km 28>10 km 6
37 georeferenced · 9 without coordinates
Open the mapnot free-living46
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions146 of 253 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 85 |
| Olocation not on record | 66 |
| BIO-UNIPIlocation not on record | 60 |
| Oskarshamn, SE | 51 |
| SLU Artdatabankenlocation not on record | 50 |
| Karlsruhe, DE | 39 |
| Christchurch, NZ | 38 |
| Beijing, CN | 36 |
| Chapingo, MX | 35 |
| Salzburg, AT | 33 |
| Yangling, CN | 32 |
| Görlitz, DE | 31 |
| Auckland, NZ | 30 |
| MeiseBGlocation not on record | 29 |
| BFLlocation not on record | 29 |
| València, ES | 29 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 28 |
| Durango, MX | 27 |
| Uniwersytet Warszawskilocation not on record | 26 |
| Kuopio, FI | 24 |
| Universidad de Antioquia (UdeA)location not on record | 24 |
| Santa Barbara, US | 22 |
| Trondheim, NO | 22 |
| Moscow State Universitylocation not on record | 21 |
| Chengdu, CN | 20 |
| KMNlocation not on record | 20 |
| Tartu, EE | 19 |
| Mlocation not on record | 18 |
| Philadelphia, US | 18 |
| MAlocation not on record | 17 |
| Bern, CH | 17 |
| Mount Annan, AU | 17 |
| Barcelona, ES | 16 |
| BDBClocation not on record | 16 |
| Canadian Department of Agriculturelocation not on record | 16 |
| South Kensington, GB | 15 |
| Entomological Society of Latvialocation not on record | 14 |
| Provincia di Livornolocation not on record | 14 |
| Adam Mickiewicz University in Poznańlocation not on record | 13 |
| Mexico City, MX | 13 |
| Riverside, US | 13 |
| Saint Louis, US | 12 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 12 |
| Jyväskylä, FI | 11 |
| Hobart, AU | 10 |
| Pamplona, ES | 10 |
| BClocation not on record | 10 |
| Claremont, US | 10 |
| Stockholm, SE | 9 |
| Uppsala, SE | 9 |
| Museo Entomologico de Leonlocation not on record | 9 |
| Oulu, FI | 8 |
| Chongqing Museumlocation not on record | 8 |
| Canberra, AU | 8 |
| Universidad Católica de Oriente (UCO)location not on record | 8 |
| Adelaide, AU | 8 |
| Porvoo, FI | 7 |
| Québec, CA | 7 |
| AVElocation not on record | 7 |
| UNESClocation not on record | 7 |
| San Luis Obispo, US | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| Philadelphia, US | 7 |
| Universidad Nacional de Colombia (UNAL)location not on record | 6 |
| Seoul, KR | 6 |
| Criciúma, BR | 6 |
| DBF-NHMDlocation not on record | 6 |
| 盐城国家级珍禽自然保护区location not on record | 6 |
| ROM007location not on record | 5 |
| Wlocation not on record | 5 |
| Kunming, CN | 5 |
| Allentown, US | 5 |
| UChlocation not on record | 5 |
| Bergen, NO | 5 |
| Tula State Universitylocation not on record | 5 |
| Nijmegen, NL | 5 |
| Helsinki, FI | 5 |
| CASlocation not on record | 5 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 5 |
| Denver, US | 5 |
| GJOlocation not on record | 5 |
| Maringá, BR | 5 |
| Xining, CN | 5 |
| WTUlocation not on record | 5 |
| TROMlocation not on record | 5 |
| Wuhan, CN | 5 |
| Zürich, CH | 5 |
| Zhengzhou, CN | 5 |
| Salamanca, ES | 5 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| Vancouver, CA | 4 |
| Foz do Iguaçu, BR | 4 |
| QAUlocation not on record | 4 |
| Porto Alegre, BR | 4 |
| University of Stellenboschlocation not on record | 4 |
| ASUlocation not on record | 4 |
| GMBAlocation not on record | 4 |
| Zapopan, MX | 4 |
| Guangzhou, CN | 4 |
| Torreón, MX | 4 |
| Burlington, US | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Blumenau, BR | 4 |
| TAFORI-LSRClocation not on record | 3 |
| PRClocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| BRNUlocation not on record | 3 |
| Córdoba, AR | 3 |
| Mexico City, MX | 3 |
| Jaén, ES | 3 |
| US | 3 |
| Puebla, MX | 3 |
| Madrid, ES | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Tromso University Museumlocation not on record | 3 |
| Bronx, US | 3 |
| Changsha, CN | 3 |
| Nanjing, CN | 3 |
| Davis, US | 3 |
| Austin, US | 3 |
| Urumqi, CN | 3 |
| Turku, FI | 2 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 2 |
| POL003location not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Flagstaff, US | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| Winterthur, CH | 2 |
| Rovaniemi, FI | 2 |
| Tsukuba, JP | 2 |
| nbflocation not on record | 2 |
| BISHlocation not on record | 2 |
| Palmerston North, NZ | 2 |
| Kagoshima, JP | 2 |
| Pelotas, BR | 2 |
| UEMlocation not on record | 2 |
| Parkville, AU | 2 |
| Vitoria, ES | 2 |
| New Haven, US | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Honolulu, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Kew, GB | 2 |
| Université Lavallocation not on record | 2 |
| Long Beach, US | 2 |
| Alexandria Universitylocation not on record | 2 |
| Pullman, US | 2 |
| ROM023location not on record | 2 |
| WNNUlocation not on record | 2 |
| Tilburg, NL | 2 |
| Badajoz, ES | 2 |
| Victoria, CA | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Wuhan, CN | 2 |
| Northridge, US | 2 |
| Riobamba, EC | 2 |
| San Diego, US | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Frankfurt am Main | 2 |
| Shanxi Universitylocation not on record | 2 |
| Glarus, CH | 2 |
| Guilin, CN | 2 |
| Porrentruy, CH | 1 |
| Córdoba, ES | 1 |
| Corvallis, US | 1 |
| Tlalnepantla, MX | 1 |
| Firenze, IT | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| La Paz, BO | 1 |
| Rotorua, NZ | 1 |
| FJIDClocation not on record | 1 |
| San Francisco, US | 1 |
| Alicante, ES | 1 |
| Sevilla, ES | 1 |
| Arequipa, PE | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Chiba, JP | 1 |
| Jinghong, CN | 1 |
| HUN003location not on record | 1 |
| Xiamen, CN | 1 |
| San Jose, US | 1 |
| Irvine, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| KR | 1 |
| Sagamihara, JP | 1 |
| Nagano City, JP | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Portland, US | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Xinxiang, CN | 1 |
| Valparaíso, CL | 1 |
| Fukushima Universitylocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Masindi, UG | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Dresden, DE | 1 |
| Bothell, US | 1 |
| Mexico City, MX | 1 |
| Granada, ES | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Cambridge, US | 1 |
| UNICAMPlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| San Francisco, US | 1 |
| Anchorage, US | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Otaru, JP | 1 |
| FUVATESlocation not on record | 1 |
| Montecillo, Texcoco, MX | 1 |
| USP-IBlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| San Sebastián, ES | 1 |
| US | 1 |
| UFRRJlocation not on record | 1 |
| UIBlocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| Brussel, BE | 1 |
| UNESP-FCAlocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Fulda, DE | 1 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 1 |
| Smithfield, AU | 1 |
| PUC-RSlocation not on record | 1 |
| UFSClocation not on record | 1 |
| UnBlocation not on record | 1 |
| Boise, US | 1 |
| Portland, US | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| San Isidro, AR | 1 |
| Los Angeles, US | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Odawara, JP | 1 |
| Tallinn, EE | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Morelia, MX | 1 |
| Juriquilla, MX | 1 |
| McWane Science Centerlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| College Park, US | 1 |
| Madison, US | 1 |
| Ann Arbor, US | 1 |
| Göteborg, SE | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
253 institutions · 1 756 of 1 958 vouchered records shown · 155 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Calendula officinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map6 countries0
between wall and pavement
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 12.6–20.5
Seasonal swing summer↔winter15.3 °C
Max temp (day)20.5 °C 14.5–24.2
Min temp (night)10.4 °C 8.90–17.4
Precipitation76.3 mm/mo 14.7–145
Air humidity61.3 % 57.7–65.1
Moisture balance-23.0 mm/mo
Vapour deficit804 Pa 513–903
Wind speed3.50 m/s
Cloud cover41.2 % 30.3–60.9
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.