Calendula arvensis
speciesAt a glance
Occurrence records47 320
Data sources12
Biological traits70
DNA specimens33
eDNA detections24
Sources12 archives
Databases and archives Calendula arvensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility47 320 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources70 traits
Chemical compositionLOTUS · NPASS52 compounds
Occurrence & distributionGBIF47 320 records
Environmental DNA1 datasets · 5 countries24 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB · GoaT2.6 Gbp
01Narrative
Calendula arvensis, le souci des champs ou souci sauvage, est une espèce de plantes à fleurs dicotylédones de la famille des Asteraceae. La plante est parfois appelée souci des Vignes, gauchefer ou fleur de tous les mois.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length12.5 mm
Leaf length45 mm
Leaf length max60 mm
Leaf length min20 mm
Leaf mass40.83 mg
Leaf size948 mm²
Leaf width8.5 mm
⚠ sources differ — AusTraits: 8.5 mm · GIFT: 10 mm
Leaf width max18 mm
Leaf width min3 mm
Plant height0.15 m
⚠ sources differ — GIFT: 0.15 m · AusTraits: 0.225 m · LEDA: 0.15 m · TRY: 0.2 m
Plant height generative0.15 m
Plant height max0.5 m
Plant height min0.05 m
Seed length8.5 mm
Seed length max8.5 mm
Seed length min8.5 mm
Seed mass4.99 mg
⚠ sources differ — TRY: 4.99 mg · LEDA: 3.58 mg · GIFT: 5.34 mg
Seed mass max9.88 mg
Seed mass min2.6 mg
Seed width3 mm
Seed width max3 mm
Seed width min3 mm
Life cycle & reproduction21
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeself
⚠ sources differ — LEDA: chamaechor · GIFT: unspecialized
Flower colourorange
Flower length max4 mm
Flower length min2.5 mm
Flower width max25 mm
Flower width min7 mm
Flowering endApr
Flowering startFeb
Flowering timennnnnnnnyyyn
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number5
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 400 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTCoastal
Leaf compoundnesssimple
Leaf formnarrow-elliptic
Leaf shapelanceolate oblong
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)94.3 mg/g
Photosynthetic pathwayC3
Seed longevity index0.25
Specific leaf area (SLA)21.71 mm²/mg
⚠ sources differ — TRY: 21.71 mm²/mg · LEDA: 29.33 mm²/mg · GIFT: 29.33 mm²/mg
Other traits7
Diaspore typeone-seeded generative dispersule
Leaf arrangementalternate
Plant support typefree-standing
Seeds per fruit101-1000
Shoot length max60 cm
Shoot length min5 cm
Shoot orientationprostrate
03Chemical composition52 compounds
Compounds documented for Calendula arvensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aromadendrane sesquiterpenoids14
Oleanane triterpenoids10
Cembrane diterpenoids8
Eudesmane sesquiterpenoids6
Bisabolane sesquiterpenoids2
Documented compounds52 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,2E,4R,8S,11S,12R)-4,12-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[9.3.1]pentadec-2-en-6-one | present | NPASS | |
| (1S,2E,4S,8S,11R,12S)-4,11-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[10.2.1]pentadec-2-en-6-one | present | NPASS | |
| (1S,2E,4S,8S,11S,12R)-4,12-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[9.3.1]pentadec-2-en-6-one | present | NPASS | |
| (2S,3R,4S,5R,6R)-2-[[(1aR,4R,4aS,7R,7aS,7bS)-1,1,4,7-tetramethyl-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulen-4-yl]oxy]-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5R,6S)-2-[[(1R,4R,5R,6R,7S,10R)-4,10-dimethyl-7-propan-2-yl-4-tricyclo[4.4.0.01,5]decanyl]oxy]-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aR,14aR,14bR)-4,4,6a,6b,11,11,14b-heptamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,5-dihydroxy-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aR,14aR,14bR)-4,4,6a,6b,11,11,14b-heptamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3-hydroxy-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aR,14aR,14bR)-4,4,6a,6b,11,11,14b-heptamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-4-[(3S)-4-carboxy-3-hydroxy-3-methylbutanoyl]oxy-3,5-dihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (4aS,6aR,6aS,6bR,8aR,10S,12aR,14bR)-10-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS |
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calendula arvensis has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes6
GenBank sequences10
eDNA detections24
Countries6
The DNA barcodea real sequence read deposited for this species
TGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGC …
Calendula arvensis isolate UQU ALP134 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Calendula arvensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 630 820 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Calendula arvensis2.63 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 44 n = 22
Ploidy4× tetraploid · measured
Chromosome records14–462n range44median44mode64records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4439×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — SCRUGLI A., MULAS B., DE MARTIS B. - 1974. Numeri cromosomici per la flora italiana:190-195.. Inform. Bot. Ital. , 6(3): 312-318.
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · fl-europaea — Femandes i& Queiros
CCDB · mediterranean
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1993. Chromosome numbers of north African phanerogams. II. Willdenowia 23: 211–238.
CCDB · ipcn-api-dl — Vogt, R. & A. Aparicio. 1999. Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus. Bocconea 11: 117–169.
CCDB · ipcn-api-dl — Scrugli, A. 1974. Numeri cromosomici per la flora Italiana: 167-171. Inform. Bot. Ital. 6: 37–43.
CCDB · ipcn-api-dl — Borgen, L. 1975. Chromosome numbers of vascular plants from Macaronesia. Norweg. J. Bot. 22: 71–76.
CCDB · ipcn-api-dl — Heyn, C., O. DAGAN & B. NACHMAN. 1974. The annual Calendula species: Taxonomy and relationships. Israel J. Bot. 23: 169–201.
CCDB · ipcn-api-dl — Gallego, M. J. 1983. Números 290-294, in Números cromosómicos para la flora española. 257-300. Lagascalia 12: 131–132.
CCDB · book-ipcn66 — Meusel &Ohle 1966
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1970-71. Sur la caryologie de quelque plantes recoltees pendant la Illeme reunion de botanique peninsulaire. Mem. Soc. Broteriana 21: 343-385.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-ipcn73-74 — VAN LOON, J. 1974. A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · book-ipcn73-74 — NORDENSTAM, B. 1972. Chromosome numbers in some Compositae from Egypt. Bot. Notiser 125: 393-396.
CCDB · book-ipcn73-74 — PODLECH, D., & o. BADER. 1974. Chromosomenstudien an Afghanischen Pflanzen II. Mitt. Bot. Mtinchen 11; 457-488.
CCDB · book-indian_vol1 — Meuse!, H. & Ohle, H. 1966; Fernan- des, A. & Queiros, M. 1970-1971 ; Dahlgren, R. et al. 1971 ; Strother, J. L. 1972 ; Powell, A.M. et al. 1974 ; Van Loon, J.C. 1974
CCDB · book-fedorov — Meuse!, Ohle 1966
CCDB · Cave1962 — Janaki Ammal & S. 1962
CCDB · CromoCat 2015 — Malallah, G. A. & Brown, G. (1999). Determination of chromosome number of Kuwaiti flora I Cytologia 64: 181-196
CCDB · CromoCat 2015 — Borgen, L. (1975). Chromosome numbers of vascular plants from Macaronesia. Norweg. J. Bot. 22: 71-76.
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971b). Sur la caryologie de quelques plantes récoltées pendant la IIIème Réunion de Botanique Péninsulaire. Mem. Soc. Brot. 21: 343-385.
CCDB · CromoCat 2015 — Heyn, C. C., Dagan, O. & Nachman, B. (1974). The annual Calendula species: taxonomy and relationships. Israel J. Bot. 23: 169-201.
CCDB · CromoCat 2015 — Loon van, J. C. (1974). A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · CromoCat 2015 — Reynaud, C., R. Verlaque & G. Bonin. (1994). Reports (372-376). Fl. Medit. 4: 286-290.
CCDB · CromoCat 2015 — Scrugli, A., B. Mulas & B. De Martis. (1974). Numeri cromosomici per la flora italiana: 190-195. Inf. Bot. Ital. 6: 312-318.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.
2n 367×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1
CCDB · book-indian_vol1 — Negodi, G. 1935, 1937a ; Janaki Ammal, E.K. & Sobti, S.N. 1962
CCDB · book-fedorov — Negodi 1935, 1937a
CCDB · book-fedorov — Janaki Ammal, Sobti 1962
CCDB · book-atlas-flowering-plants — Negodi 1936a
CCDB · CromoCat 2015 — Malallah, G. A. & Brown, G. (1999). Determination of chromosome number of Kuwaiti flora I Cytologia 64: 181-196
CCDB · CromoCat 2015 — Negodi, G. (1935). Reperti cariologici su Fanerogami. Atti Soc. Mat. Modena 67: 7-9.
CCDB · CromoCat 2015 — Negodi, G. (1937c). Caratteri nucleari e morfologici in alcune Calendulae (Compositae-Tubuliflorae). Ann. Bot., Rome 21: 510-518
2n 426×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · book-ipcn73-74 — BORGEN, L. 1974. Chromosome numbers of Macaronesian flowering plants! II. Norwegian J. Bot. 21: 195-210.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · CromoCat 2015 — Borgen, L. (1974). Chromosome numbers of Macaronesian flowering plants II. Norweg. J. Bot. 21: 195-210.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
2n 144×CCDB · iber-fl · CCDB · book-ipcn75-78 · CCDB · book-fedorov +1
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · book-fedorov — Negodi 1935, 1937a
CCDB · book-atlas-flowering-plants — Negodi 1935
2n 183×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · book-indian_vol1 — Humphries, C.J. et at. 1978
CCDB · CromoCat 2015 — Humphries, C. J., Murray, B. G., Bocquet, G. & Vasudevan, K. N. (1978). Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131(4): 391-404.
2n 302×CCDB · book-ipcn66 · CCDB · book-fedorov
CCDB · book-ipcn66 — Meusel &Ohle 1966
CCDB · book-fedorov — Meuse!, Ohle 1966
2n -11×CCDB · asterace
CCDB · asterace — Negodi 1937a Ann. Bot. (Roma)
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Malallah, G. A. & Brown, G. (1999). Determination of chromosome number of Kuwaiti flora I Cytologia 64: 181-196
2n 281×CCDB · book-fedorov
CCDB · book-fedorov — Reese 1957
2n 321×CCDB · Cave1962
CCDB · Cave1962 — Janaki Ammal 1962a
2n 461×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Rashid, A. 1974
n 228×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn73-74 +2
CCDB · ipcn-api-dl — Aparicio Martínez, A. 1989. Números cromosomáticos de plantas occidentales, 487--507. Anales Jard. Bot. Madrid 45: 483–494.
CCDB · ipcn-api-dl — Malallah, G. A. & G. Brown. 1999. Determination of chromosome number of Kuwaiti flora I. Cytologia 64: 181–196.
CCDB · book-ipcn72 — STROTHER, J.L. 1972. Chromosome studies in western North American Compositae. Amer. J. Bot. 59: 242-247.
CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · Cave1962 — Janaki Ammal & S. 1962
CCDB · CromoCat 2015 — Aparicio, A. (1989). Números cromosomáticos de plantas occidentales, 487-507. Anales Jard. Bot. Madrid 45: 483-494.
CCDB · CromoCat 2015 — Powell, A. M., D. W. Kyhos & P. H. Raven. (1974). Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · CromoCat 2015 — Malallah, G. A. & Brown, G. (1999). Determination of chromosome number of Kuwaiti flora I Cytologia 64: 181-196
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Malallah, G. A. & Brown, G. (1999). Determination of chromosome number of Kuwaiti flora I Cytologia 64: 181-196
n 232×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · book-ipcn73-74 — RASHID, A. 1974. Chromosome number of some Mediterranean plants. Bangladesh J. Bot. 3: 75-82.
CCDB · CromoCat 2015 — Rashid, A. (1974). Chromosome number of some Mediterranean plants. Bangladesh J. Bot. 3: 75-82.
n 141×CCDB · Cave1957
CCDB · Cave1957 — Reese
n 181×CCDB · ita-fl
CCDB · ita-fl — NEGODI G. - 1937. Caratteri nucleari e morfologici in alcune Calendulae (Compositae-Tubuliflorae).. Ann. Bot. (Rome) , 21(3): 510-518.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type47 320 records
Wild obs. + sensor43 530
Museum / vouchered3 359
Cultivated / captive15
Other416
Origin
Native4 642
Introduced269
Range
Area of Occupancy AOO84 448 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 10 803≤1 km 8 211≤10 km 11 512>10 km 501
31 027 georeferenced · 12 503 without coordinates
Open the mapobservation + sensor43 530
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 224≤1 km 607≤10 km 474>10 km 57
1 362 georeferenced · 1 997 without coordinates
Open the institutions mapphysical evidence3 359
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 1
2 georeferenced · 13 without coordinates
Open the mapnot free-living15
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions93 of 172 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 375 |
| Berlin, DE | 367 |
| CICYTEXlocation not on record | 206 |
| LDlocation not on record | 169 |
| AVElocation not on record | 163 |
| València, ES | 133 |
| Adelaide, AU | 112 |
| MAlocation not on record | 77 |
| ISAlocation not on record | 59 |
| College of the Atlantic, Museumlocation not on record | 59 |
| BDBClocation not on record | 59 |
| Barcelona, ES | 58 |
| Badajoz, ES | 57 |
| BClocation not on record | 54 |
| AVE, ORTlocation not on record | 48 |
| CJBGlocation not on record | 48 |
| Jardín Botánico Canario Viera y Clavijo, Unidad Asociada al CSIClocation not on record | 42 |
| Mount Annan, AU | 41 |
| Instituto Canario de Investigaciones Agrarias (ICIA)location not on record | 41 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 41 |
| Alicante, ES | 37 |
| Madrid, ES | 35 |
| UIBlocation not on record | 34 |
| Moscow State Universitylocation not on record | 32 |
| Brisbane, AU | 30 |
| BFLlocation not on record | 28 |
| Wlocation not on record | 26 |
| Uniwersytet Wrocławskilocation not on record | 26 |
| Salamanca, ES | 25 |
| Canadian Department of Agriculturelocation not on record | 24 |
| Museo Entomologico de Leonlocation not on record | 23 |
| MeiseBGlocation not on record | 22 |
| Canberra, AU | 20 |
| Edinburgh, GB | 19 |
| Hobart, AU | 18 |
| Kew, GB | 18 |
| Vitoria, ES | 18 |
| Entomological Society of Latvialocation not on record | 18 |
| Tartu Fungal Culture Collectionlocation not on record | 17 |
| Phyletisches Museum Jenalocation not on record | 17 |
| Pamplona, ES | 17 |
| Saint Louis, US | 17 |
| Sevilla, ES | 15 |
| Córdoba, ES | 15 |
| Oskarshamn, SE | 14 |
| Santa Cruz, US | 13 |
| Kochi, JP | 12 |
| Görlitz, DE | 12 |
| Nagano City, JP | 11 |
| BMlocation not on record | 11 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 11 |
| PRClocation not on record | 11 |
| Davis, US | 11 |
| San Sebastián, ES | 10 |
| Odawara, JP | 10 |
| Armidale, AU | 10 |
| Riverside, US | 10 |
| GMBAlocation not on record | 10 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 9 |
| CASlocation not on record | 9 |
| Adam Mickiewicz University in Poznańlocation not on record | 8 |
| San Diego, US | 7 |
| QAUlocation not on record | 7 |
| John May Museum of Natural Historylocation not on record | 7 |
| Frankfurt am Main | 7 |
| UChlocation not on record | 7 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 7 |
| Coimbra, PT | 7 |
| SLU Artdatabankenlocation not on record | 6 |
| Granada, ES | 6 |
| Paris, FR | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Olocation not on record | 6 |
| Bern, CH | 6 |
| San Luis Obispo, US | 6 |
| Bourges, FR | 6 |
| South Kensington, GB | 5 |
| Uppsala, SE | 5 |
| Lausanne, CH | 5 |
| Stockholm, SE | 5 |
| Zürich, CH | 4 |
| University of Stellenboschlocation not on record | 4 |
| Victoria, CA | 4 |
| Sagamihara, JP | 4 |
| GJOlocation not on record | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Beijing, CN | 4 |
| KURAlocation not on record | 3 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 3 |
| Laboratory of Palaeontologylocation not on record | 3 |
| Mlocation not on record | 3 |
| Arcata, US | 3 |
| Zürich, CH | 3 |
| BRNUlocation not on record | 3 |
| Nagatoro-machi, Chichibu-gun, JP | 3 |
| Santa Barbara, US | 3 |
| Claremont, US | 3 |
| Pamplona, ES | 3 |
| Parkville, AU | 2 |
| Valparaiso, CL | 2 |
| Viña del Mar, CL | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Christchurch, NZ | 2 |
| Tomioka, JP | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| WAGlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Salzburg, AT | 2 |
| Hazara Universitylocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Dresden, DE | 2 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 2 |
| Banyoles, ES | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Tsukuba, JP | 2 |
| GHPG$location not on record | 2 |
| Xiamen, CN | 2 |
| Provincia di Livornolocation not on record | 2 |
| Salvador, BR | 2 |
| JBSlocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Corrientes, AR | 1 |
| Santiago de Compostela, ES | 1 |
| Porvoo, FI | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Karlsruhe, DE | 1 |
| University of Readinglocation not on record | 1 |
| Monastir, TN | 1 |
| PrivatHerblocation not on record | 1 |
| H-Drencklocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| EL PASO, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Gijón, ES | 1 |
| WTUlocation not on record | 1 |
| Jaén, ES | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Boise, US | 1 |
| Vancouver, CA | 1 |
| ER Hellerlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Bronx, US | 1 |
| Rishon Le Zion, IL | 1 |
| Angwin, US | 1 |
| Porrentruy, CH | 1 |
| IPE-CSIClocation not on record | 1 |
| Sion, CH | 1 |
| Yangling, CN | 1 |
| San Francisco, US | 1 |
| Oulu, FI | 1 |
| JP | 1 |
| MAF, TFC, SALAlocation not on record | 1 |
| Guangzhou, CN | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| University of Patraslocation not on record | 1 |
| Valparaíso, CL | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| KR | 1 |
| Pretoria, ZA | 1 |
| US | 1 |
| Philadelphia, US | 1 |
| H-Meierottlocation not on record | 1 |
| San Isidro, AR | 1 |
| Moscow, US | 1 |
| Nijmegen, NL | 1 |
| Córdoba, AR | 1 |
172 institutions · 3 218 of 3 359 vouchered records shown · 136 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Calendula arvensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map5 countries0
gardencoastal sage scrub and patches of chaparral,…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.0 °C -6.00–24.2
Seasonal swing summer↔winter17.4 °C
Max temp (day)18.7 °C -2.00–31.4
Min temp (night)12.1 °C -10.1–16.2
Precipitation55.5 mm/mo 4.40–70.4
Air humidity60.3 % 43.8–64.0
Moisture balance-39.2 mm/mo
Vapour deficit726 Pa 145–1,848
Wind speed4.30 m/s
Cloud cover40.2 % 22.6–55.1
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.