Calectasia narragara

R.L.Barrett & K.W.Dixon · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Dasypogonaceae/Calectasia

At a glance

Occurrence records746

Data sources8

Biological traits22

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Calectasia narragara's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility746 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~2.01 Gbp↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF746 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT2 Gbp

01Narrative

Calectasia narragara, commonly known as a blue tinsel lily or star of Bethlehem, is a plant in the family Dasypogonaceae growing as a tufted rhizomatous herb. It is endemic to the south-west of Western Australia and common in most of its range.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length9.35 mm

Leaf width0.7 mm

Plant height0.45 m

⚠ sources differ — AusTraits: 0.45 m · TRY: 0.3 m

Plant height max0.8 m

Plant height min0.3 m

Life cycle & reproduction6

Flowering timennnnyyyyyynn

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calectasia narragara has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLJX088666.1 ↗157 747 bp

ACGT

GAATAAAAAAAATTATAGAACAATATCTTGATCTTGTTTTATCAAGATCAAGATATTGATCCTTTCGTTCAACGATTCGTATACACTAAA …

Calectasia narragara plastid, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1

plant barcode

06Genome at a glanceGoaT

The complete instruction manual Calectasia narragara carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 012 883 673 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calectasia narragara2.01 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type746 records

Wild obs. + sensor429

Museum / vouchered316

Cultivated / captive1

Origin

Native4

Range

Area of Occupancy AOO1 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 213≤1 km 53≤10 km 20>10 km 25

311 georeferenced · 118 without coordinates

Open the mapobservation + sensor429

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 40≤1 km 28≤10 km 171>10 km 33

272 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence316

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	131
Museo Entomologico de Leonlocation not on record	79
Adelaide, AU	36
Canberra, AU	35
Brisbane, AU	14
South Kensington, GB	5
Mount Annan, AU	4
Kew, GB	4
Hobart, AU	3
BGPAlocation not on record	2
Boise, US	1
BRNUlocation not on record	1
LDlocation not on record	1

13 institutions · 316 of 316 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Calectasia narragara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)