Calectasia intermedia

Sond. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Dasypogonaceae/Calectasia

At a glance

Occurrence records605

Data sources7

Biological traits26

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Calectasia intermedia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility605 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF605 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Calectasia intermedia, commonly known as blue tinsel-lily or eastern tinsel lily is a species of flowering plant in the family Dasypogonaceae, endemic to the border areas of western Victoria and south-eastern South Australia and flowering in early spring. It is the only member of the genus Calectasia that is not endemic to Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length11.25 mm

Leaf width0.65 mm

Plant height0.4 m

Plant height max0.5 m

Plant height min0.3 m

Seed length5 mm

Life cycle & reproduction8

Dispersal typewind

Flowering timennnnnnnnyynn

Life formsubshrub or rhizomatous subshrub

Life spanperennial

Pollination syndromeinsect

Raunkiær life formchamaephyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

⚠ sources differ — TRY: W · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calectasia intermedia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLAF206743.1 ↗1 402 bp

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACCCCTGACTACGTAACCAAAGATACTGATATCTTGGCAGC …

Calectasia intermedia ribulose 1,5-bisphosphate carboxylase (rbcL) gene, partial cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type605 records

Wild obs. + sensor419

Museum / vouchered186

Origin

Native19

Range

Area of Occupancy AOO1 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 137≤1 km 96≤10 km 65>10 km 14

312 georeferenced · 107 without coordinates

Open the mapobservation + sensor419

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 17≤1 km 35≤10 km 95>10 km 26

173 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence186

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	100
Adelaide, AU	39
Canberra, AU	27
Brisbane, AU	4
Parkville, AU	3
Mount Annan, AU	3
Kensington, AU	2
Hobart, AU	2
Armidale, AU	2
Kew, GB	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
La Trobe Universitylocation not on record	1

12 institutions · 185 of 186 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Calectasia intermedia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)