Calectasia cyanea

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Dasypogonaceae/Calectasia

At a glance

Occurrence records115

Data sources9

Biological traits23

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Calectasia cyanea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Calectasia cyanea, commonly known as the star of Bethlehem or blue tinsel lily, is a plant in the family Dasypogonaceae growing as a perennial herb and is endemic to the south–west of Western Australia. Restricted to a single population in Torndirrup National Park, it is critically endangered.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length9.85 mm

Leaf width0.85 mm

Plant height0.5 m

Plant height max0.6 m

Plant height min0.1 m

Life cycle & reproduction6

Flowering timennnnnyyyyynn

Life formperennial or subshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calectasia cyanea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

rbcLAY123231.1 ↗1 337 bp

ACGT

GCTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACCCCTGACTACGTAACCAAAGATACTGATATCTTGGCAGCATTC …

Calectasia cyanea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid gene for plastid product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Calectasia cyanea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — ANWAY, J.C. 1969. The evolution and taxonomy of Calectasia cyanea R. Br. (Xanthorrhoeaceae) in terms of its present-day variation and cytogenetics. Austral. J. Bot. 17: 147-159.

n 91×CCDB · book-ipcn67-71

08Occurrence & distribution

Record type115 records

Wild obs. + sensor29

Museum / vouchered69

Cultivated / captive17

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 25>10 km 4

29 georeferenced

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 4≤10 km 47>10 km 4

55 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence69

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 17

17 georeferenced

Open the mapnot free-living17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	12
Museo Entomologico de Leonlocation not on record	10
BGPAlocation not on record	8
South Kensington, GB	6
Philadelphia, US	4
Armidale, AU	4
John T. Waterhouse Herbariumlocation not on record	3
Parkville, AU	3
Auckland, NZ	3
Canberra, AU	3
Claremont, US	2
Wellington, NZ	2
Palmerston, AU	2
Phoenix, US	1
US	1
Kew, GB	1
Joondalup, AU	1
Adelaide, AU	1

18 institutions · 67 of 69 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Calectasia cyanea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)