Caleana minor

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Caleana

At a glance

Occurrence records1 365

Data sources7

Biological traits30

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Caleana minor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF1 365 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Caleana minor, commonly known as the small duck orchid or flying duck orchid, is a species of orchid native to eastern Australia and the North Island of New Zealand. It has a single reddish brown, grass-like leaf and up to four yellowish to reddish flowers on a wiry flowering stem. The sepals and petals are directed downwards near the broad column wings and the labellum is directed upwards and covered with warty glands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Leaf length90 mm

Leaf length max120 mm

Leaf length min30 mm

Leaf width3 mm

Leaf width max3 mm

Plant height0.18 m

Plant height max0.15 m

Plant height min0.08 m

Life cycle & reproduction8

Dispersal typewind

Flowering timeynnnnnnnnyyy

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caleana minor has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF539925.1 ↗698 bpAustralia

ACGT

ATCATTGTCGAGACCCAAAATAGATCGAGCAATTCTGATAACATGTAATCTTCACTAGTGGCGGCGGCGAAACTCGTTGTCGTCCACCAC …

Paracaleana minor isolate s1037 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type1 365 records

Wild obs. + sensor947

Museum / vouchered413

Cultivated / captive5

Origin

Native229

Range

Area of Occupancy AOO2 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 294≤1 km 140≤10 km 275>10 km 161

870 georeferenced · 77 without coordinates

Open the mapobservation + sensor947

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 22≤1 km 73≤10 km 239>10 km 43

377 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence413

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 4

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	130
Museo Entomologico de Leonlocation not on record	104
Mount Annan, AU	53
Adelaide, AU	46
Brisbane, AU	20
Hobart, AU	19
Smithfield, AU	12
Armidale, AU	9
QVMAGlocation not on record	6
Batemans Bay, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Rotorua, NZ	2
Bronx, US	1
Philadelphia, US	1
Wellington, NZ	1
Kensington, AU	1
Christchurch, NZ	1
La Trobe Universitylocation not on record	1

18 institutions · 412 of 413 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Caleana minor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Caleana minor

At a glance

Sources7 archives

Size & morphology8

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 365 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 365 records