Caleana major

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Caleana

At a glance

Occurrence records4 116

Data sources8

Biological traits34

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Caleana major's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF4 116 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Caleana major, commonly known as the large duck orchid, is a small orchid found in eastern and southern Australia.Les Robinson - Field Guide to the Native Plants of Sydney, page 241 This terrestrial plant features a remarkable flower, resembling a duck in flight. The flower is an attractant to insects, such as male sawflies which pollinate the flower in a process known as pseudocopulation. In 1986 this orchid was featured on an Australian postage stamp.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf length80 mm

Leaf mass per area40.55 g/m2

Leaf size590 mm²

Leaf width8 mm

Leaf width max12 mm

Plant height0.3 m

Plant height max0.4 m

Plant height min0.18 m

Seed mass0.01 mg

⚠ sources differ — TRY: 0.01 mg · AusTraits: 0.001 mg

Life cycle & reproduction11

Dispersal typewind

Flowering endFeb

Flowering startSep

Flowering timeyynnnnnnyyyy

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapenarrowly_lanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caleana major has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAF347996.1 ↗702 bp

ACGT

ATCACTATCGAGACTCGAAAGAGACCGAGAAATTCTAATAACTTGTGAGCTGAACTAGAGGCATCGCCAGAACTTGACGCCGCCCATCAC …

Caleana major 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type4 116 records

Wild obs. + sensor3 471

Museum / vouchered640

Cultivated / captive5

Origin

Native206

Range

Area of Occupancy AOO8 292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 1 408≤1 km 583≤10 km 356>10 km 657

3 004 georeferenced · 467 without coordinates

Open the mapobservation + sensor3 471

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 27≤1 km 89≤10 km 436>10 km 34

586 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence640

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 1≤10 km 2>10 km 1

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	149
Canberra, AU	137
Mount Annan, AU	119
Adelaide, AU	63
Brisbane, AU	59
Hobart, AU	35
Smithfield, AU	24
QVMAGlocation not on record	16
Armidale, AU	14
La Trobe Universitylocation not on record	4
Batemans Bay, AU	4
John T. Waterhouse Herbariumlocation not on record	3
NSW Dept of Planning, Industry and Environmentlocation not on record	3
MAlocation not on record	1
Paris, FR	1
Wellington, NZ	1
Wollongong, AU	1
Parkville, AU	1
Philadelphia, US	1
Kensington, AU	1
Monastir, TN	1
South Kensington, GB	1
Palmerston, AU	1

23 institutions · 640 of 640 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Caleana major was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Caleana major

At a glance

Sources8 archives

Size & morphology9

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type4 116 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 116 records