Calathea lasiostachya

Donn.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Marantaceae/Calathea

At a glance

Occurrence records347

Data sources6

Biological traits11

DNA specimens11

eDNA detections7

Sources6 archives

Databases and archives Calathea lasiostachya's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility347 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF347 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI11 specimens

01Narrative

Calathea lasiostachya là một loài thực vật có hoa trong họ Marantaceae. Loài này được Donn.Sm. mô tả khoa học đầu tiên năm 1901.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calathea lasiostachya has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences9

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX995972.1 ↗443 bpCosta Rica

ACGT

GTCACGACATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATTGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTCGGCCGA …

Calathea lasiostachya isolate 95948816 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type347 records

Wild obs. + sensor16

Museum / vouchered331

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3≤10 km 1

7 georeferenced · 9 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 331 records without

Open the institutions mapphysical evidence331

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	89
National Biodiversity Institute, Costa Ricalocation not on record	79
Museo Nacional de Costa Rica (MNCR)location not on record	56
Durham, US	47
San José, CR	11
Riverside, US	5
Area de Conservacion Guanacastelocation not on record	5
Kew, GB	4
Vancouver, CA	3
Berlin, DE	3
WTUlocation not on record	2
Mexico City, MX	2
Chicago, US	2
León, NI	2
Durango, MX	2
ASUlocation not on record	2
Kunming, CN	1
MAlocation not on record	1
University of Stellenboschlocation not on record	1
SCZlocation not on record	1
UBClocation not on record	1
MEXUlocation not on record	1

22 institutions · 320 of 331 vouchered records shown · 8 without an institution code

09Environmental DNA7 detections

Where the DNA of Calathea lasiostachya was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 20.6–23.9

Seasonal swing summer↔winter2.30 °C

Max temp (day)25.5 °C 24.6–26.7

Min temp (night)21.0 °C 17.4–21.8

Precipitation273 mm/mo 253–478

Air humidity73.2 % 71.2–74.7

Moisture balance158 mm/mo 125–344

Vapour deficit748 Pa 699–751

Wind speed1.70 m/s 1.00–1.80

Cloud cover31.5 % 27.5–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)