Calathea guzmanioides

L.B.Sm. & Idrobo · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Marantaceae/Calathea

At a glance

Occurrence records248

Data sources6

Biological traits11

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Calathea guzmanioides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility248 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF248 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Calathea guzmanioides là một loài thực vật có hoa trong họ Marantaceae. Loài này được L.B.Sm. & Idrobo mô tả khoa học đầu tiên năm 1948.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 530 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calathea guzmanioides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJQ341278.1 ↗823 bp

ACGT

TTCGCCGCTCGTGACGTCTTGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGC …

Calathea guzmanioides voucher S.Suarez 2322 (COL) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type248 records

Wild obs. + sensor28

Museum / vouchered220

Origin

Native9

Range

Area of Occupancy AOO500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 6≤1 km 6≤10 km 3>10 km 6

21 georeferenced · 7 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 1≤1 km 3≤10 km 22

26 georeferenced · 194 without coordinates

Open the institutions mapphysical evidence220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	61
National Biodiversity Institute, Costa Ricalocation not on record	42
Museo Nacional de Costa Rica (MNCR)location not on record	21
Universidad Nacional de Colombia (UNAL)location not on record	21
Universidad Tecnológica del Chocó (UTCH)location not on record	9
Göteborg, SE	9
Vancouver, CA	7
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	7
Riverside, US	6
Xiamen, CN	5
San José, CR	4
Stockholm, SE	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
Berlin, DE	3
QCNElocation not on record	3
Aarhus, DK	2
Kew, GB	2
Chicago, US	2
University of Stellenboschlocation not on record	2
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record	1
Bronx, US	1
UBClocation not on record	1
Santiago de Cali, CO	1

23 institutions · 216 of 220 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Calathea guzmanioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)