Calanthe sylvatica

(Thouars) Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Calanthe

At a glance

Occurrence records1 862

Data sources11

Biological traits16

DNA specimens4

eDNA detections4

Sources11 archives

Databases and archives Calanthe sylvatica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 862 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionNPASS8 compounds

Occurrence & distributionGBIF1 862 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Calanthe sylvatica is a species of orchid. It is native to tropical and southern Africa from Sierra Leone to Tanzania to South Africa, as well as Madagascar, Comoros, Mauritius and Réunion.Kew World Checklist of Selected Plant Families

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.65 m

⚠ sources differ — GIFT: 0.65 m · TRY: 0.7 m

Plant height max0.64 m

Seed mass0.007 mg

Life cycle & reproduction3

Life formpseudobulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 000 m

Elevation min15 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Calanthe sylvatica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Spirostane steroids2

Lanostane, Tirucallane and Euphane triterpenoids1

Cholestane steroids $ Stigmastane steroids1

Cholestane steroids $ Ergostane steroids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,8R,9R,10R,13R,14R,17R)-17-[(E,2S,5S)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8S,9R,10R,13S,14S,17S)-17-[(2R,5R)-5,6-dimethylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
Deltonin	present	NPASS
Diosgenin	present	NPASS
GMBQZIIUCVWOCD-GXEIHQLLSA-N	present	NPASS
Lanosterol	present	NPASS
OBVNUYXMOLOYPW-KYIWPAQZSA-N	present	NPASS
OLAMGHNQGZIWHZ-ZEZWSVOGSA-N	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calanthe sylvatica has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP714389.1 ↗607 bp

ACGT

ATCGAGCGATTCAGAGAACTCGTGAATAAAAGTGGCGACAATTGTTGTCACAAAATAATCGTCTTATTCATTGCTTCATCTCTTTTGGGA …

Calanthe sylvatica voucher W.Yang20 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Calanthe sylvatica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records20–522n range40median40mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 407×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +1

CCDB · book-ipcn65 — Tanaka 1965a

CCDB · ipcn-api-dl — Hsu, C. 1976. Cytological studies on the economically promising wild Orchids found on Taiwan. Proc. Natl. Sci. Council (Taiwan). 9: 61–78.

CCDB · ipcn-api-dl — Ishida, G. 1990. Karyomorphological studies in Calanthe, Orchidaceae. Bull. Hiroshima Bot. Gard. 12: 1–69.

CCDB · book-ipcn66 — Larsen 1966a

CCDB · book-fedorov — Tanaka R. 1965b

CCDB · book-fedorov — Chardard 1963

2n 201×CCDB · book-ipcn72

CCDB · book-ipcn72 — HSU, C-C. 1972. Preliminary chromosome studies on the vascular plants of Taiwan (V). Cytotaxonomy on some monocotyledons. Taiwania 17: 48-65.

2n 521×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.

n 202×CCDB · book-ipcn67-71 · CCDB · Cave1963

CCDB · book-ipcn67-71 — MEHRA, P.N., & S.P. VIJ. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.

CCDB · Cave1963 — Chardard 1963

n 211×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Mehra & Sehgal 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 862 records

Wild obs. + sensor1 467

Museum / vouchered395

Origin

Native1

Range

Area of Occupancy AOO1 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 115≤1 km 43≤10 km 753>10 km 426

1 337 georeferenced · 130 without coordinates

Open the mapobservation + sensor1 467

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 8≤1 km 4≤10 km 14>10 km 3

29 georeferenced · 366 without coordinates

Open the institutions mapphysical evidence395

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	64
Guangzhou, CN	42
Saint Louis, US	30
Beijing, CN	22
Pretoria, ZA	19
South Kensington, GB	18
Guilin, CN	15
Cape Town, ZA	13
Paris, FR	12
Nishihara, JP	10
Tsukuba, JP	9
Taipei, TW	9
Taipei, TW	7
Kunming, CN	6
Plocation not on record	6
CJBGlocation not on record	6
Uppsala, SE	5
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	5
BRLUlocation not on record	5
MAlocation not on record	4
Durban, ZA	4
Yaoundé, CM	4
Glocation not on record	3
National Herbarium of São Tomé and Principelocation not on record	3
Kew, GB	3
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	3
TAFORI-LSRClocation not on record	2
Coimbra, PT	2
Cape Town, ZA	2
Arusha, TZ	2
DSMlocation not on record	2
EAlocation not on record	2
Clocation not on record	1
Bloomington, US	1
Brussels, BE	1
Servico de Microbiologia e Imunologialocation not on record	1
WAGlocation not on record	1
Herbier National du Gabonlocation not on record	1
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	1
Xiamen, CN	1
Moscow State Universitylocation not on record	1
TAIElocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
LBVlocation not on record	1

44 institutions · 351 of 395 vouchered records shown · 42 without an institution code

09Environmental DNA4 detections

Where the DNA of Calanthe sylvatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calanthe sylvatica

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment8

Other traits1

Compound class profile4 classes

Documented compounds8 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 862 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 44 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 862 records