Calanthe striata

R.Br. ex Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Calanthe

At a glance

Occurrence records80

Data sources9

Biological traits8

DNA specimens7

eDNA detections12

Sources9 archives

Databases and archives Calanthe striata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF80 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Calanthe sieboldii là một loài thực vật có hoa trong họ Lan. Loài này được Decne. ex Regel mô tả khoa học đầu tiên năm 1868.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calanthe striata has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKT338665.1 ↗627 bp

ACGT

TTCAGAGAACCCGTGAATAAAAGTGGCGGCAGTTGTTGTCACAGAATAATCGTCTTATTCATTGCCCCATCTCTTTTGGGAAGGGGGAAT …

Calanthe striata var. sieboldii isolate 536 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Calanthe striata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4014×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +2

CCDB · book-ipcn65 — Tanaka 1965a

CCDB · ipcn-api-dl — Hsu, C. 1976. Cytological studies on the economically promising wild Orchids found on Taiwan. Proc. Natl. Sci. Council (Taiwan). 9: 61–78.

CCDB · ipcn-api-dl — Tanaka, R., K. KARASAWA & G. Ishida. 1981. Karyomorphological observations on Calanthe of Japan. Bull. Hiroshima Bot. Gard. 4: 9–62.

CCDB · ipcn-api-dl — Kim, Y. s. & S. h. Kim. 1989. A taxonomic study of Calanthe in Korea. Korean J. Pl. Taxon. 19: 273–287.

CCDB · ipcn-api-dl — Ishida, G. 1990. Karyomorphological studies in Calanthe, Orchidaceae. Bull. Hiroshima Bot. Gard. 12: 1–69.

CCDB · book-ipcn73-74 — TANAKA, R. 1974. Organizational system of meiotic division and the development of reproductive cells in higher plants. The Cell 6: 22-25

CCDB · eflora

CCDB · book-fedorov — Miduno 1940b

CCDB · book-fedorov — Mutsuura, Nakahira

CCDB · book-fedorov — Tanaka R. j965b)

CCDB · book-fedorov — Tanaka R. 1965b

n 201×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — TERASAKA, o., & R. TANAKA. 1974. Cytological studies on the nuclear differentiation in microspore division of some angiosperms. Bot. Mag. (Tokyo) 87: 209-217.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type80 records

Wild obs. + sensor76

Museum / vouchered4

Range

Area of Occupancy AOO232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 20≤1 km 4≤10 km 2>10 km 48

74 georeferenced · 2 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	2
Bronx, US	1

2 institutions · 3 of 4 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Calanthe striata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.90 °C 9.80–10.0

Seasonal swing summer↔winter28.2 °C

Max temp (day)14.5 °C 13.6–15.5

Min temp (night)4.20 °C 3.30–5.00

Precipitation31.9 mm/mo 17.4–46.5

Air humidity51.5 % 46.9–56.2

Moisture balance-49.5 mm/mo -86.1–-12.9

Vapour deficit671 Pa 546–796

Wind speed3.80 m/s 3.20–4.40

Cloud cover30.2 % 25.4–35.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)