Calanthe rubens

Ridl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Calanthe

At a glance

Occurrence records11

Data sources11

Biological traits9

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Calanthe rubens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF11 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Calanthe rubens is a species of orchid. It is native to the Philippines, Thailand and Malaysia and generally grows at elevations above 300 feet. It is warm growing and deciduous, commencing growth in spring and flowering in autumn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calanthe rubens has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences9

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKF560486.1 ↗629 bpViet Nam

ACGT

ATCGAGCGATTCGGCGAACTCGTGAATAAAAGCGGCGGCAGTTGCTGCCGCGGAACAGTCGTCCCAATCGTCGCCTCATCTCCTTTGGGG …

Calanthe rubens voucher J.W. Zhai 014 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Calanthe rubens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidydiploid inferred

Chromosome records42–442n range43median44mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 422×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ishida, G. 1990. Karyomorphological studies in Calanthe, Orchidaceae. Bull. Hiroshima Bot. Gard. 12: 1–69.

CCDB · ipcn-api-dl — Teoh, S. B. 1980. Cytological studies in Malayan members of the Phaius tribe (Orchidaceae). 11. MeLotic and B-chromosomes. Caryologia 33: 483–493.

2n 442×CCDB · book-ipcn65 · CCDB · ipcn-api-dl

CCDB · book-ipcn65 — Tanaka 1965a

CCDB · ipcn-api-dl — Ishida, G. 1990. Karyomorphological studies in Calanthe, Orchidaceae. Bull. Hiroshima Bot. Gard. 12: 1–69.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type11 records

Wild obs. + sensor3

Museum / vouchered8

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA2 detections

Where the DNA of Calanthe rubens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 25.2–25.2

Seasonal swing summer↔winter6.00 °C

Max temp (day)29.6 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity63.4 %

Moisture balance21.8 mm/mo

Vapour deficit1,175 Pa

Wind speed3.20 m/s

Cloud cover64.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)