Calanthe densiflora

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Calanthe

At a glance

Occurrence records183

Data sources9

Biological traits10

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Calanthe densiflora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF183 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Calanthe densiflora is a species of orchid. It is native to Nepal, eastern India, Bhutan, Bangladesh, Myanmar, Thailand, Vietnam, Nansei-shoto (the Ryukyu Islands) and China (Guangdong, Guangxi, Hainan, Sichuan, Taiwan, Tibet, and Yunnan).Kew World Checklist of Selected Plant FamiliesFlora of China, v 25 p 295, 密花虾脊兰 mi hua xia ji lan, Calanthe densiflora

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous geophyte or epiphyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max3 000 m

Elevation min1 700 m

Epiphytefacultative

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calanthe densiflora has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF560520.1 ↗614 bpChina

ACGT

ATCGAACGATTTGGAGAACCCGTGAATAAAAGTTGCGACAATTGTTGTCGCGGAACAATCGTCTCAATCGTTGTCTTATCTCTTTTGGGG …

Calanthe densiflora voucher J.W. Zhai 173 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Calanthe densiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 404×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Hsu, C. 1976. Cytological studies on the economically promising wild Orchids found on Taiwan. Proc. Natl. Sci. Council (Taiwan). 9: 61–78.

CCDB · ipcn-api-dl — Ishida, G. 1990. Karyomorphological studies in Calanthe, Orchidaceae. Bull. Hiroshima Bot. Gard. 12: 1–69.

CCDB · ipcn-api-dl — Tanaka, R., K. KARASAWA & G. Ishida. 1981. Karyomorphological observations on Calanthe of Japan. Bull. Hiroshima Bot. Gard. 4: 9–62.

CCDB · eflora

n 202×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — VIJ, S. P. & N. Shekhar. 1983. In: IOPB chromosome number reports LXXXI. Taxon 32: 668.

CCDB · ipcn-api-dl — Tanaka, R., K. KARASAWA & G. Ishida. 1981. Karyomorphological observations on Calanthe of Japan. Bull. Hiroshima Bot. Gard. 4: 9–62.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type183 records

Wild obs. + sensor69

Museum / vouchered114

Range

Area of Occupancy AOO488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 7≤1 km 8≤10 km 3>10 km 36

54 georeferenced · 15 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	22
Kunming, CN	21
Guangzhou, CN	12
Chengdu, CN	8
Saint Louis, US	7
Guilin, CN	6
South Kensington, GB	6
Taipei, TW	6
Taipei, TW	5
Harvard Universitylocation not on record	3
Nishihara, JP	3
Chengdu, CN	2
Yangling, CN	2
Taipei, TW	2
Edinburgh, GB	2
Yunnan Universitylocation not on record	1
Nanjing, CN	1
Servico de Microbiologia e Imunologialocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1

19 institutions · 111 of 114 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Calanthe densiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)