Calamus vitiensis

Warb. ex Becc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Calamus

At a glance

Occurrence records198

Data sources4

Biological traits35

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Calamus vitiensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility198 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF198 records

DNA & barcodingNCBIsequences

01Narrative

Calamus ledermannianus est une espèce de plantes de la famille des Arecaceae. Son épithète spécifique rend hommage au botaniste Carl Ludwig Ledermann.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length11 mm

⚠ sources differ — AusTraits: 11 mm · GIFT: 11.75 mm

Fruit length max15 mm

Fruit length min10 mm

Fruit width9 mm

⚠ sources differ — AusTraits: 9 mm · GIFT: 11 mm

Fruit width max13.5 mm

Fruit width min8.5 mm

Leaf length2 700 mm

Leaf length max4 000 mm

Leaf width70 mm

Petiole length22.5 cm

Plant height15 m

⚠ sources differ — AusTraits: 15 m · TRY: 20.5 m

Seed length7 mm

Life cycle & reproduction5

Flowering timennnnnnynnnnn

Life formliana

Life spanperennial

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit colourwhite

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

⚠ sources differ — AusTraits: palmoid · TRY: Climber

Habitat GIFTcanopy

Leaf compoundnesscompound

Leaf shapenarrowly_ovate

Woodinesswoody

Other traits5

Dbh max6 cm

Defenseyes

Leaf spinesyes

Shoot length max2 600 cm

Shoot orientationerect

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calamus vitiensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG886842.1 ↗735 bpIndonesia

ACGT

ATGTCACCCCCAAACAGAAACTTGAAGCTTTTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTCACTTATTATACTCCTGAATACG …

UNVERIFIED: Calamus vitiensis voucher LDS295(BO) ribulose-1,5-biphosphate carboxylase/oxygenase large subunit-like (rbcL) gene, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type198 records

Wild obs. + sensor21

Museum / vouchered166

Other11

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 8≤1 km 3≤10 km 3

14 georeferenced · 7 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 17≤1 km 20≤10 km 24>10 km 11

72 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	97
Kew, GB	29
Brisbane, AU	17
Canberra, AU	8
Bronx, US	4
Tampa, US	4
Museo Entomologico de Leonlocation not on record	1
Xiamen, CN	1

8 institutions · 161 of 166 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)