Calamus muelleri

H.Wendl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Calamus

At a glance

Occurrence records2 048

Data sources8

Biological traits39

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Calamus muelleri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 048 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF2 048 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Calamus muelleri là loài thực vật có hoa thuộc họ Arecaceae. Loài này được H.Wendl. mô tả khoa học đầu tiên năm 1875.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length13 mm

Fruit width13 mm

Fruit width max16 mm

Fruit width min10 mm

Leaf length150 mm

Leaf length max1 000 mm

Leaf length min300 mm

Leaf mass per area74.52 g/m2

Leaf width30 mm

Leaf width max60 mm

Leaf width min30 mm

Petiole length1 cm

Plant height20 m

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnnnnnnny

Life formliana

Life spanperennial

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit colouryellow

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

⚠ sources differ — AusTraits: palmoid · TRY: Climber

Habitat GIFTcanopy

Leaf compoundnesscompound

Leaf shapeelliptical lanceolate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density556 mg/cm³

Other traits4

Dbh max1.6 cm

Defenseyes

Leaf spinesyes

Shoot length max2 000 cm

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calamus muelleri has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896129.1 ↗510 bpAustralia

ACGT

TATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAGCA …

Calamus muelleri voucher 1076420450 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Calamus muelleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-fedorov

CCDB · book-fedorov — Read 1965b

n 131×CCDB · book-ipcn65

CCDB · book-ipcn65 — Read 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 048 records

Wild obs. + sensor1 689

Museum / vouchered138

Cultivated / captive2

Other219

Origin

Native17

Introduced5

Range

Area of Occupancy AOO3 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 267≤1 km 134≤10 km 41>10 km 30

1 472 georeferenced · 217 without coordinates

Open the mapobservation + sensor1 689

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 19≤1 km 15≤10 km 47>10 km 41

122 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence138

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	41
Museo Entomologico de Leonlocation not on record	24
Mount Annan, AU	21
Smithfield, AU	13
Canberra, AU	11
Armidale, AU	8
Adelaide, AU	7
John T. Waterhouse Herbariumlocation not on record	4
Hobart, AU	2
US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
James Cook Townsvillelocation not on record	1
Miami, US	1
Burlington, US	1

15 institutions · 137 of 138 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Calamus muelleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calamus muelleri

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction7

Diet & foraging1

Habitat & environment12

Physiology & chemistry2

Other traits4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 048 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 048 records