Calamus moti

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Calamus

At a glance

Occurrence records383

Data sources7

Biological traits42

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Calamus moti's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility383 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources42 traits

Occurrence & distributionGBIF383 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Calamus moti is a climbing rainforest plant in the palm family Arecaceae, which is endemic to Queensland. It has a slim flexible stem which does not support the plant, instead it climbs to the forest canopy with the assistance of long tendrils armed with stout recurved hooks.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length11 mm

⚠ sources differ — AusTraits: 11 mm · GIFT: 13 mm

Fruit width10.5 mm

⚠ sources differ — AusTraits: 10.5 mm · GIFT: 13 mm

Leaf length1 750 mm

Leaf length max4 000 mm

Leaf mass per area40.6 g/m2

Leaf size11 250 mm²

Leaf width30 mm

Petiole length1 cm

Plant height41 m

⚠ sources differ — AusTraits: 41 m · TRY: 45 m

Seed length9.5 mm

Seed mass107 mg

⚠ sources differ — TRY: 107 mg · AusTraits: 134 mg · GIFT: 107 mg

Seed mass max107 mg

Seed mass min107 mg

Seed volume110 mm³

Seed volume max110 mm³

Seed volume min110 mm³

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnyynnnn

Life formliana

Life spanperennial

Pollination syndromebeetle

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit colourwhite

Fruit fleshinessfleshy

Fruit typedrupe

Growth formclimber

Habitat GIFTcanopy

Leaf compoundnesscompound

Leaf shapelanceolate linear

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits4

Dbh max5 cm

Defenseyes

Leaf spinesyes

Shoot length max4 500 cm

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calamus moti has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496468.1 ↗559 bpAustralia · 2013

ACGT

CTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCT …

Calamus moti isolate UB01 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type383 records

Wild obs. + sensor158

Museum / vouchered120

Other105

Origin

Native5

Range

Area of Occupancy AOO784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 68≤1 km 37≤10 km 17>10 km 6

128 georeferenced · 30 without coordinates

Open the mapobservation + sensor158

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 5≤1 km 9≤10 km 26>10 km 13

53 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	77
Brisbane, AU	15
Canberra, AU	14
Mount Annan, AU	5
James Cook Townsvillelocation not on record	4
Kew, GB	1
Museo Entomologico de Leonlocation not on record	1
University of the Sunshine Coastlocation not on record	1

8 institutions · 118 of 120 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Calamus moti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 22.0–22.9

Seasonal swing summer↔winter13.9 °C

Max temp (day)28.3 °C 28.2–28.4

Min temp (night)16.8 °C 15.3–18.2

Precipitation63.9 mm/mo 25.2–103

Air humidity52.6 % 45.2–60.0

Moisture balance-98.6 mm/mo -134–-63.5

Vapour deficit1,348 Pa 1,128–1,569

Wind speed3.60 m/s 3.20–3.90

Cloud cover19.9 % 18.5–21.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)