Calamus javensis

Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Calamus

At a glance

Occurrence records429

Data sources5

Biological traits29

DNA specimens2

eDNA detections0

Sources5 archives

Databases and archives Calamus javensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility429 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF429 records

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Rotan lilin adalah sejenis rotan yang dipakai untuk tali-temali, macam-macam kerajinan, dan dahulu sempat diekspor ke luar negeri pada zaman Hindia Belanda. Sejak zaman Hindia Belanda, tumbuhan ini sudah diperjualbelikan. Di Indonesia, karena varietasnya yang banyak, rotan lilin punya macam-macam nama daerah; seperti, rotan lilin, r. mancik, r. puh, r. opot (Bngk.), r. pělěděs, r. sěrimit (Plb.), r. sěni, r. tělingkong daon, r. těmiang, howè omas, h. cacing, r. angkut, dan r. sěga tikus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length10.12 mm

Fruit length max15 mm

Fruit length min12 mm

Fruit width7.5 mm

Fruit width max12 mm

Fruit width min8 mm

Leaf length max650 mm

Plant height17.5 m

⚠ sources differ — GIFT: 17.5 m · TRY: 12.5 m

Plant height max10 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formliana

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit colourwhite

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Habitat GIFTboth

Woodinesswoody

Physiology & chemistry4

Leaf n21.5 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)19.61 mm²/mg

Other traits4

Dbh max5 cm

Defenseyes

Leaf spinesyes

Shoot length max4 000 cm

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calamus javensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK304504.1 ↗442 bpSingapore · 2018

ACGT

CATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCCAGCATAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTAACC …

Calamus javensis isolate 11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type429 records

Wild obs. + sensor1

Museum / vouchered428

Range

Area of Occupancy AOO932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 5≤1 km 127≤10 km 14>10 km 2

148 georeferenced · 280 without coordinates

Open the institutions mapphysical evidence428

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	212
Xiamen, CN	22
South Kensington, GB	19
Paris, FR	6
Bronx, US	4
Cibinong Science Center, Herbarium Bogorienselocation not on record	2

6 institutions · 265 of 428 vouchered records shown · 163 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)