Calamus caryotoides

A.Cunn. ex Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Calamus

At a glance

Occurrence records335

Data sources9

Biological traits43

DNA specimens6

eDNA detections3

Sources9 archives

Databases and archives Calamus caryotoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility335 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF335 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Calamus caryotoides là loài thực vật có hoa thuộc họ Arecaceae. Loài này được A.Cunn. ex Mart. mô tả khoa học đầu tiên năm 1838.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length11.5 mm

⚠ sources differ — AusTraits: 11.5 mm · GIFT: 15 mm

Fruit length max20 mm

Fruit length min10 mm

Fruit width11.5 mm

Fruit width max15 mm

Fruit width min8 mm

Leaf length325 mm

Leaf length max400 mm

Leaf mass per area167 g/m2

Leaf size5 618 mm²

Leaf width60 mm

Petiole length6 cm

Plant height15 m

Seed length10 mm

Seed mass97.71 mg

⚠ sources differ — TRY: 97.71 mg · AusTraits: 119 mg · GIFT: 97.71 mg

Seed mass max97.71 mg

Seed mass min97.71 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyynnnnnnyy

Life formliana

Life spanperennial

Pollination syndromebeetle

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit colourbrown

Fruit fleshinessfleshy

Fruit typedrupe

Growth formclimber

Habitat GIFTcanopy

Leaf compoundnesscompound

Leaf shapeobtriangular

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits4

Dbh max2 cm

Defenseyes

Leaf spinesyes

Shoot length max1 500 cm

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calamus caryotoides has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences4

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJQ667287.1 ↗552 bpAustralia

ACGT

AGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGCA …

Calamus caryotoides voucher JCU_IA09 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLarpL32-trnLrps16-trnK

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Calamus caryotoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records26–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Janaki Ammal

CCDB · book-fedorov — D. 1945)

CCDB · book-atlas-flowering-plants — E.K.J.*

2n 261×CCDB · book-fedorov

CCDB · book-fedorov — Read 1965b

n 131×CCDB · book-ipcn65

CCDB · book-ipcn65 — Read 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type335 records

Wild obs. + sensor93

Museum / vouchered169

Cultivated / captive1

Other72

Origin

Native7

Introduced1

Range

Area of Occupancy AOO748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 48≤1 km 16≤10 km 2>10 km 3

69 georeferenced · 24 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 32≤1 km 13≤10 km 47>10 km 19

111 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence169

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	76
Brisbane, AU	50
Canberra, AU	10
Museo Entomologico de Leonlocation not on record	7
Mount Annan, AU	7
James Cook Townsvillelocation not on record	5
Miami, US	4
Kew, GB	3
John T. Waterhouse Herbariumlocation not on record	2
Xiamen, CN	1
Armidale, AU	1
Adelaide, AU	1
Palmerston, AU	1

13 institutions · 168 of 169 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Calamus caryotoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)