Calamagrostis arundinacea
(L.) Roth · speciesAt a glance
Occurrence records120 241
Data sources11
Biological traits39
DNA specimens16
eDNA detections11
Sources11 archives
Databases and archives Calamagrostis arundinacea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility120 241 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources39 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF120 241 records
Environmental DNA1 datasets · 6 countries11 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB2.7 Gbp
01Narrative
Calamagrostis arundinacea, le calamagrostis faux-roseau, est une espèce de plantes monocotylédones de la famille des Poaceae, sous-famille des Pooideae, originaire d'Eurasie. - Noms vernaculaires - calamagrostis faux-roseau, calamagrostide à feuilles de roseau, calamagrostis à feuilles de roseau, roseau des montagnes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology7
Leaf mass115 mg
Leaf size1 111 mm²
⚠ sources differ — TRY: 1 111 mm² · LEDA: 2 457 mm² · GIFT: 2 457 mm²
Plant height0.75 m
⚠ sources differ — GIFT: 0.75 m · LEDA: 0.75 m · TRY: 0.989 m
Plant height generative1.11 m
Plant height max1.5 m
Plant height min0.4 m
Seed mass0.446 mg
⚠ sources differ — TRY: 0.446 mg · LEDA: 0.495 mg · GIFT: 16.45 mg
Life cycle & reproduction12
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeanimal
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years3 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Seed number1 191
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 300 m
Elevation min2 200 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Habitat GIFTforest, mountains
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio28.28 g/g
Leaf c452 mg/g
Leaf dry-matter content (LDMC)328 mg/g
⚠ sources differ — TRY: 328 mg/g · LEDA: 372 mg/g
Leaf n19.8 mg/g
Leaf p3.48 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)16.93 mm²/mg
⚠ sources differ — TRY: 16.93 mm²/mg · LEDA: 22.78 mm²/mg · GIFT: 22.78 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition3 compounds
Compounds documented for Calamagrostis arundinacea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Ergot alkaloids1
Fatty alcohols1
Flavonols1
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Ergocristine | present | LOTUS | |
| Hexacosan-1-ol | present | LOTUS | |
| Quercetin 3-rutinoside | present | LOTUS |
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calamagrostis arundinacea has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes6
GenBank sequences10
eDNA detections11
Countries6
The DNA barcodea real sequence read deposited for this species
AGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAGCCTGCCGGCGGCGG …
Calamagrostis arundinacea voucher WYJ202008022 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Calamagrostis arundinacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 650 380 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Calamagrostis arundinacea2.65 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records28–562n range28median28mode57records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2841×CCDB · slov-fl · CCDB · iapt · CCDB · poland +7
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Sorokin, S. N. 1991. Chromosome numbers in the members of the family Poaceae from the European part of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1331–1332.
CCDB · ipcn-api-dl — Sorokin, S. N. 1993. Karyosystematic study of some members of the tribe Aveneae (Poaceae). Bot. Žhurn. (Moscow & Leningrad) 78(4): 36–47.
CCDB · ipcn-api-dl — Petrova, A. & K. Stoyanova. 1998. Mediterranean chromosome number reports 8 (941--960). Fl. Medit. 8: 251–262.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1980. A karyotaxonomic study of the grasses of the Altai Mts. Bot. Zhurn. 65 (4): 509–520.
CCDB · ipcn-api-dl — Andreev, V. N. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 397.
CCDB · ipcn-api-dl — Paszko, B. 2006. A critical review and a new proposal of karyotype asymmetry indices. Pl. Syst. Evol. 258: 39–48.
CCDB · book-ipcn75-78 — Hindakova 1974
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1977
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova in Tzvelev 1976
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol2 — Avdulov, N .P. (Fedorov) ; Tischler, G. 1934 ; Rohweder, H. 1937 ; Nygren, A. 1946; Sorsa, V. 1962 ; Andreev, N. 1979
CCDB · book-fedorov — ABAYJIOB 1931
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Roh~eder 1937
CCDB · book-fedorov — Nygren 1946
CCDB · book-fedorov — Sorsa V. 1962
CCDB · book-atlas-flowering-plants — Nygren 1946
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Enushchenko, I. V. & Chepinoga, A. V. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · CromoCat 2015 — Holub, J., Mesícek, J. & Javürková, V. (1972). Annotated chromosome counts of Czechoslovak plants (31-60). Folia Geobot. Phytotax. (Bohem.) 7: 167-202.
CCDB · CromoCat 2015 — Probatova, N.S., Seledets, V.P., Rudyka, E.G., Gnutikov, A.A., Kozhevnikova, Z.V. & Barkalov V.Y. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1284-1288
CCDB · CromoCat 2015 — Andreev, N. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 397.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1986b). Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapovedniki Belorussii Issledovaniia 10: 24-28.
CCDB · CromoCat 2015 — Guzik, M. B. (1984). Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82-86
CCDB · CromoCat 2015 — Kozuharov, S. & Kuzmanov, B. (1970). Cytotaxonomic studies on Bulgarian Gramincae. III. Bull. Inst. Bot. 20: 99-108.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1976). Chromosome studies of the higher plants with euroasiatic distribution in Bulgaria. Fragm. Florist. Geobot. 22(3): 301-322.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Petrova, A. & K. Stoyanova. (1998). Mediterranean chromosome number reports-8. Fl. Medit. 8: 251-262.
CCDB · CromoCat 2015 — Semerenko, L. V. (1989). Chisla khromosom nekotorykh pretstavitelei semeistv Asteraceae, Fabaceae, Orchidaceae, Poaceae flory Berezinskogo Biosfernogo Zapovednika (BSSR). Bot. Žurn. 74(11): 1671-1673.
CCDB · CromoCat 2015 — Sorokin, S.N. (1991). Chromosome numbers in the members of the family Poaceae from the European part of the USSR. Bot. Zurn. 76:1331-1332
CCDB · CromoCat 2015 — Sorokin, S.N. (1993). Karyosistematic study of some members of the tribe Aveneae (Poaceae). Bot. Zurn. 78(4):36-47
2n 428×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · ipcn-api-dl — Rudyka, E. G. 1988. Chromosome numbers in some vascular plant species from the far east of the USSR. Bot. Žhurn. (Moscow & Leningrad) 73: 294–295.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Kariologicheskoe issledovanie sosudistykh rastenij ostrovov Dal'nevostocnogo gosudarstvennogo morskogo sapovednika. Sb. Cvetkaye Rastenija Ostrovov Dalnevostochnogo Morskogo Sapovednika. 92–114.
CCDB · ipcn-api-dl — Tateoka, T. 1976. Chromosome numbers of the genus Calamagrostis in Japan. Bot. Mag. (Tokyo) 89: 99–114.
CCDB · ipcn-api-dl — Probatova, N. S. 2000. Chromosome numbers in some plant species from the Razdolnaya (Suifun) river basin (Primorsky Territory). Bot. Žhurn. (Moscow & Leningrad) 85(12): 102–107.
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1977
CCDB · iapt — IAPT/IOPB Chromosome Data 18
CCDB · Cave1956supp — Tateoka 1954
2n 568×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iapt
CCDB · ipcn-api-dl — Probatova, N. S. 1984. New taxa of the Poaceae from the Far East of the USSR. Bot. Zhurn. SSSR 69(2): 251–259.
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova in Tzvelev 1976
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1977
CCDB · Cave1956supp — Tateoka 1954
2n 212×CCDB · book-ipcn72 · CCDB · book-indian_vol2
CCDB · book-ipcn72 — HSU, C-C. 1972. Preliminary chromosome studies on the vascular plants of Taiwan (V). Cytotaxonomy on some monocotyledons. Taiwania 17: 48-65.
CCDB · book-indian_vol2 — Hsu, C.-C. 1972
2n 491×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 26
n 141×CCDB · Cave1963
CCDB · Cave1963 — Sorsa 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type120 241 records
Wild obs. + sensor104 699
Museum / vouchered13 016
Cultivated / captive51
Other2 475
Origin
Native91
Range
Area of Occupancy AOO197 232 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy72% within 1 km
≤100 m 34 271≤1 km 31 479≤10 km 24 424>10 km 939
91 113 georeferenced · 13 586 without coordinates
Open the mapobservation + sensor104 699
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy30% within 1 km
≤100 m 755≤1 km 2 517≤10 km 6 809>10 km 718
10 799 georeferenced · 2 217 without coordinates
Open the institutions mapphysical evidence13 016
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 1
1 georeferenced · 50 without coordinates
Open the mapnot free-living51
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions71 of 166 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 7 850 |
| Moscow State Universitylocation not on record | 636 |
| Helsinki, FI | 512 |
| LDlocation not on record | 313 |
| Olocation not on record | 283 |
| Uppsala, SE | 190 |
| BFLlocation not on record | 180 |
| Oulu, FI | 139 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 132 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 109 |
| Tartu, EE | 96 |
| Adam Mickiewicz University in Poznańlocation not on record | 92 |
| SLU Artdatabankenlocation not on record | 91 |
| Irkutsk State Universitylocation not on record | 89 |
| MeiseBGlocation not on record | 84 |
| Kuopio, FI | 82 |
| Tallinn, EE | 81 |
| Oskarshamn, SE | 74 |
| KR | 71 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 65 |
| Trondheim, NO | 58 |
| BIO-UNIPIlocation not on record | 55 |
| DBF-NHMDlocation not on record | 54 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 54 |
| Kyoto Universitylocation not on record | 50 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 46 |
| Turku, FI | 46 |
| BRNUlocation not on record | 41 |
| BClocation not on record | 40 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 39 |
| BDBClocation not on record | 36 |
| Uniwersytet Jagiellońskilocation not on record | 32 |
| Barcelona, ES | 30 |
| GJOlocation not on record | 30 |
| Guangzhou, CN | 30 |
| National Institute of Biological Resourceslocation not on record | 26 |
| Provincia di Livornolocation not on record | 25 |
| Elocation not on record | 25 |
| Dresden, DE | 25 |
| Jyväskylä, FI | 24 |
| Taipei, TW | 23 |
| Görlitz, DE | 23 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 22 |
| Bergen, NO | 21 |
| Salzburg, AT | 21 |
| IWEP FEB RASlocation not on record | 19 |
| Korea National Arboretumlocation not on record | 17 |
| DMZ botanic gardenlocation not on record | 16 |
| GZUlocation not on record | 15 |
| Nagasaki University - Fisherieslocation not on record | 14 |
| KMNlocation not on record | 14 |
| Zürich, CH | 14 |
| Berlin, DE | 14 |
| Vitoria, ES | 13 |
| Xining, CN | 13 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 13 |
| University of Stellenboschlocation not on record | 13 |
| Mlocation not on record | 13 |
| DNSMlocation not on record | 12 |
| nlocation not on record | 12 |
| Plocation not on record | 11 |
| Uniwersytet Warszawskilocation not on record | 11 |
| Porvoo, FI | 11 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 10 |
| Beijing, CN | 10 |
| Bern, CH | 10 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 10 |
| MAlocation not on record | 10 |
| TUR-Alocation not on record | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| Seoul, KR | 9 |
| Nanjing, CN | 9 |
| Uniwersytet Śląski w Katowicachlocation not on record | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| Wlocation not on record | 8 |
| Stockholm, SE | 8 |
| Salamanca, ES | 8 |
| Chengdu, CN | 8 |
| Auckland, NZ | 8 |
| Beijing, CN | 8 |
| CICYTEXlocation not on record | 6 |
| SZUlocation not on record | 6 |
| Karlsruhe, DE | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Bronx, US | 5 |
| València, ES | 5 |
| NSMKlocation not on record | 5 |
| LfUlocation not on record | 5 |
| KOMlocation not on record | 5 |
| ENTClocation not on record | 4 |
| H-Resselocation not on record | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Xiamen, CN | 4 |
| Tula State Universitylocation not on record | 4 |
| GMBAlocation not on record | 3 |
| Universität Göttingenlocation not on record | 3 |
| Hangzhou, CN | 3 |
| PrivatHerblocation not on record | 3 |
| SWlocation not on record | 3 |
| Pamplona, ES | 3 |
| Sant Julià de Lòria, AD | 3 |
| nbflocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Porrentruy, CH | 3 |
| TROMlocation not on record | 3 |
| Museo Achille Folettolocation not on record | 2 |
| Coimbra, PT | 2 |
| Changsha, CN | 2 |
| Zürich, CH | 2 |
| Wuhan, CN | 2 |
| Ann Arbor, US | 2 |
| Shanghai, CN | 2 |
| PRClocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Edinburgh, GB | 2 |
| Bourges, FR | 2 |
| Forssa, FI | 2 |
| Kochi, JP | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| Logan, US | 2 |
| Tromso University Museumlocation not on record | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Göteborg, SE | 2 |
| NMBU:MINAlocation not on record | 2 |
| Jaén, ES | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Dekalb, US | 1 |
| Madrid, ES | 1 |
| ENHMlocation not on record | 1 |
| Durham, US | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Tilburg, NL | 1 |
| H-Adlerlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| H-Diewaldlocation not on record | 1 |
| Burlington, US | 1 |
| Rovaniemi, FI | 1 |
| University of Hamburglocation not on record | 1 |
| Honolulu, US | 1 |
| Tampa, US | 1 |
| Durham, US | 1 |
| BMlocation not on record | 1 |
| Millersville, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Taipei, TW | 1 |
| Philadelphia, US | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Sevilla, ES | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Guilin, CN | 1 |
| KIWElocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 1 |
| Philadelphia, US | 1 |
| Chongqing Museumlocation not on record | 1 |
| Granada, ES | 1 |
| SJNAlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Lausanne, CH | 1 |
166 institutions · 12 633 of 13 016 vouchered records shown · 268 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Calamagrostis arundinacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 3.30–16.5
Seasonal swing summer↔winter23.4 °C
Max temp (day)18.5 °C 6.20–20.2
Min temp (night)9.30 °C 0.3–12.9
Precipitation72.4 mm/mo 62.3–123
Air humidity62.1 % 58.2–65.2
Moisture balance-1.80 mm/mo -26.4–25.1
Vapour deficit690 Pa 356–785
Wind speed2.90 m/s 2.50–4.30
Cloud cover46.7 % 39.0–53.3
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.