Cadaba fruticosa

(L.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Cadaba

At a glance

Occurrence records302

Data sources12

Biological traits7

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Cadaba fruticosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility302 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF302 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Cadaba fruticosa is a species of plant in the family Capparaceae. It is endemic on Indian Subcontinent: Bangladesh, India, Pakistan, Sri Lanka and Indo-China: Myanmar. Its habitat includes the dry parts of the Gangetic plain, down through the Vindhya range, to Deccan thorn scrub forests South India. It is threatened by habitat loss. It is known from Pakistan and Bangladesh to the Gangetic plains, south to Madhya Pradesh, Maharashtra and Telangana. It is found in Rayalaseema, central and eastern parts of Karnataka and south to Tamil Nadu, west to rainshadow regions around Palakkad and Punalur. In Tamil Nadu, Cadaba fruticosa is known as '"vizhuthi"(Tamil: விழுதி (viļuti)) and used in Siddha medicine for more than 2000 years. The juice of the leaves is especially used to cure gonorrhoea (Tamil: வெண்மேகம் (věṇmēkam)).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formshrub

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Growth formshrub

Mycorrhiza typearbuscular

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Cadaba fruticosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pyrrolidine alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
L-Stachydrine		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cadaba fruticosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON316756.1 ↗479 bp

ACGT

TTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAA …

Cadaba fruticosa voucher 491 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cadaba fruticosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records18–342n range26median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-fedorov

CCDB · book-fedorov — Raghavan T. S., Ven- tracky katasubban 1941a violac

2n 341×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Subramanian, D. & G. Susheela. 1988. Cytotaxonomical studies of south Indian Capparidaceae. Cytologia 53: 679–684.

n 161×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 19

n 171×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Subramanian, D. & G. Susheela. 1988. Cytotaxonomical studies of south Indian Capparidaceae. Cytologia 53: 679–684.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type302 records

Wild obs. + sensor233

Museum / vouchered68

Other1

Range

Area of Occupancy AOO780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 57≤1 km 62≤10 km 18>10 km 8

145 georeferenced · 88 without coordinates

Open the mapobservation + sensor233

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 41

41 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	40
Pondicherry, IN	20
Gujarat Biodiversity Gene Banklocation not on record	3
McWane Science Centerlocation not on record	2
Fort Worth, US	1

5 institutions · 66 of 68 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Cadaba fruticosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 21.7–22.8

Seasonal swing summer↔winter11.9 °C

Max temp (day)29.8 °C 26.6–30.3

Min temp (night)15.7 °C 13.8–17.7

Precipitation0.9 mm/mo 0.7–1.00

Air humidity44.5 % 38.3–49.4

Moisture balance-123 mm/mo

Vapour deficit1,563 Pa 1,348–1,625

Wind speed5.70 m/s

Cloud cover14.6 % 13.0–16.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)