Cadaba farinosa

Forssk. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Cadaba

At a glance

Occurrence records1 034

Data sources13

Biological traits20

DNA specimens7

eDNA detections2

Sources13 archives

Databases and archives Cadaba farinosa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 034 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF1 034 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Cadaba farinosa is a 2–8 m high evergreen shrub or small tree that belongs to the caper family. It has simple ovate leaves with entire margins, zygomorphic, spidery, greenish, yellowish, whitish or pinkish flowers, and is covered in powdery hairs or scales, particularly the younger parts. It can be found in a zone from Senegal to India between the desert and the savanna.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height3 m

Seed mass3.55 mg

⚠ sources differ — TRY: 3.55 mg · GIFT: 7.19 mg

Seed mass max13.26 mg

Seed mass min3.55 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Habitat GIFTdry (Acacia) bushland, bushed or wooded deciduous grassland or woodland, also coastal thicket and bushland, riverine thicket

Woodinesswoody

Physiology & chemistry4

Leaf n42.44 mg/g

Leaf p0.95 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition9 compounds

Compounds documented for Cadaba farinosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile3 classes

Polyamines7

Guaiane sesquiterpenoids1

Eudesmane sesquiterpenoids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(22Z)-4-hydroxy-2-oxa-11,16,20-triazatricyclo[22.2.2.13,7]nonacosa-1(26),3,5,7(29),8,22,24,27-octaene-10,21-dione	present	LOTUS
(3aR,4S,6aR,9S,9aR,9bR)-Octahydro-4-hydroxy-9-methyl-3,6-bis(methylene)azuleno(4,5-b)furan-2,8(3H,4H)-dione	present	NPASS
(3R,3aS,5aS,9R,9aS,9bS)-Octahydro-3,5a,9-trimethylnaphtho[1,2-b]furan-2,8(3H,4H)-dione	present	LOTUS
4-Hydroxy-2-oxa-11,16,20-triazatricyclo[22.2.2.13,7]nonacosa-1(26),3,5,7(29),8,22,24,27-octaene-10,21-dione	present	LOTUS
4-Methoxy-2-oxa-11,16,20-triazatricyclo[22.2.2.13,7]nonacosa-1(26),3,5,7(29),8,22,24,27-octaene-10,21-dione	present	LOTUS
Cadabicine	present	LOTUS
Cadabicine diacetate	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cadaba farinosa has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK285134.1 ↗453 bp

ACGT

GAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTT …

Cadaba farinosa isolate UHURU1477-15 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★trnL-FtrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Cadaba farinosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–322n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-indian_vol1 · CCDB · Cave1962

CCDB · book-indian_vol1 — Mibge, J. 1962

CCDB · Cave1962 — Mige 1962

2n 321×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Baquar, S.R. et al. 1965

n 161×CCDB · book-ipcn65

CCDB · book-ipcn65 — Baquar et al. 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.964 ↗

08Occurrence & distribution

Record type1 034 records

Wild obs. + sensor639

Museum / vouchered366

Cultivated / captive21

Other8

Range

Area of Occupancy AOO2 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 16≤1 km 1≤10 km 1>10 km 1

19 georeferenced · 620 without coordinates

Open the mapobservation + sensor639

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 9≤10 km 2

12 georeferenced · 354 without coordinates

Open the institutions mapphysical evidence366

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the mapnot free-living21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	57
Saint Louis, US	36
Kew, GB	29
TAFORI-LSRClocation not on record	25
IFAN Ch. A. Dioplocation not on record	16
Adam Mickiewicz University in Poznańlocation not on record	14
MeiseBGlocation not on record	12
Berlin, DE	12
Stockholm, SE	7
Yaoundé, CM	7
HNBlocation not on record	7
EFGlocation not on record	7
Uppsala, SE	6
Edinburgh, GB	5
Baroda, IN	5
University of Stellenboschlocation not on record	5
Moscow State Universitylocation not on record	4
Xiamen, CN	3
MAlocation not on record	3
Wlocation not on record	3
CJBGlocation not on record	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
Paris, FR	2
Chongqing Museumlocation not on record	2
Bronx, US	1
San Diego, US	1
Brookings, US	1
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	1
Department of Botany Herbarium Ahmadu Bello University, Zarialocation not on record	1
LDlocation not on record	1
Universität Göttingenlocation not on record	1
Université du Lomélocation not on record	1
Centre National des Semences Forestièreslocation not on record	1
WAGlocation not on record	1
University of Hargeisalocation not on record	1
M-VascularPlantslocation not on record	1

36 institutions · 283 of 366 vouchered records shown · 83 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cadaba farinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

red soilSTRI plot

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 19.9–19.9

Seasonal swing summer↔winter2.60 °C

Max temp (day)25.1 °C

Min temp (night)14.5 °C

Precipitation110 mm/mo

Air humidity57.7 %

Moisture balance-28.7 mm/mo

Vapour deficit979 Pa

Wind speed2.60 m/s

Cloud cover43.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cadaba farinosa

At a glance

Sources13 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry4

Compound class profile3 classes

Documented compounds9 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 034 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 034 records