Cadaba aphylla

(Thunb.) Wild · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Cadaba

At a glance

Occurrence records964

Data sources8

Biological traits16

DNA specimens7

eDNA detections5

Sources8 archives

Databases and archives Cadaba aphylla's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility964 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF964 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Cadaba aphylla ("Swartstorm") is one of some 30 species in the genus Cadaba. It is indigenous to southern Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height2 m

Plant height max3 m

Plant height min1 m

Seed mass25.44 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 800 m

Elevation min20 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC4

⚠ sources differ — TRY: C4 · GIFT: C3

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cadaba aphylla has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences3

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJX572361.1 ↗535 bpSouth Africa · 2010

ACGT

TGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCA …

Cadaba aphylla voucher OM3203 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type964 records

Wild obs. + sensor733

Museum / vouchered230

Cultivated / captive1

Range

Area of Occupancy AOO2 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 524≤1 km 68≤10 km 10>10 km 20

622 georeferenced · 111 without coordinates

Open the mapobservation + sensor733

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 2≤10 km 3>10 km 5

10 georeferenced · 220 without coordinates

Open the institutions mapphysical evidence230

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	167
Cape Town, ZA	28
Kew, GB	9
Durban, ZA	6
Bronx, US	2
University of Johannesburglocation not on record	2
Royal Botanic Gardens, Kewlocation not on record	1
Görlitz, DE	1
Gujarat Biodiversity Gene Banklocation not on record	1
University of Stellenboschlocation not on record	1
MeiseBGlocation not on record	1
LNBG$location not on record	1

12 institutions · 220 of 230 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Cadaba aphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 15.7–28.3

Seasonal swing summer↔winter11.3 °C

Max temp (day)22.5 °C 20.3–34.6

Min temp (night)13.2 °C 10.0–22.8

Precipitation34.6 mm/mo 14.9–45.8

Air humidity56.5 % 52.5–59.0

Moisture balance-93.0 mm/mo -187–-75.7

Vapour deficit879 Pa 744–1,983

Wind speed4.00 m/s 4.00–4.60

Cloud cover11.6 % 9.60–19.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)