Byblis liniflora

Salisb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Byblidaceae/Byblis

At a glance

Occurrence records656

Data sources13

Biological traits27

DNA specimens9

eDNA detections8

Sources13 archives

Databases and archives Byblis liniflora's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility656 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF656 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT868 Mbp

01Narrative

Byblis liniflora is a species of carnivorous plant in the Byblidaceae family. It is found in Australia, Indonesia, and Papua New Guinea. Byblis liniflora contains acteoside (verbascoside) as do many other Lamiales.Acteoside and related phenylethanoid glycosides in Byblis liniflora Salisb. plants propagated in vitro and its systematic significance. Jan Schlauer, Jaromir Budzianowski, Krystyna Kukułczanka and Lidia Ratajczak, Acta Societatis Botanicorum Poloniae, 2004, volume 73, issue 1,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length3.35 mm

Fruit width3.7 mm

Leaf length65 mm

Plant height0.1 m

Plant height max0.5 m

Plant height min0 m

Seed length0.8 mm

Seed mass0.091 mg

⚠ sources differ — TRY: 0.091 mg · AusTraits: 0.098 mg

Seed width0.5 mm

Life cycle & reproduction6

Flowering timeyyyyyyynnnnn

Life formannual

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeterete

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Byblis liniflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives $ Phenylethanoids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
[6-[2-(3,4-Dihydroxyphenyl)ethoxy]-3,5-dihydroxy-4-(3,4,5-trihydroxy-6-methyloxan-2-yl)oxyoxan-2-yl]methyl 3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
Calceolarioside A	present	LOTUS
Verbascoside	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Byblis liniflora has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences8

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU810487.1 ↗635 bp

ACGT

CTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCTGTAGGTGACCTGCGGAGGATCATTGCCGTGACCTTGGAAGGTAGACCCGAGCACTTT …

Byblis liniflora voucher BlinKF02 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK4★rbcL3★ITS1★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Byblis liniflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size867 975 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Byblis liniflora0.87 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidy2× diploid · measured

Chromosome records24–322n range32median32mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Hanson, L., K. A. McMahon, M. A. T. Johnson & M. D. Bennett. 2001. First nuclear DNA C-values for 25 angiosperm families. Ann. Bot. (Oxford) 87: 251–258.

CCDB · kew — Hanson L, McMahon KA, Johnson MAT, Bennett MD. 2001. First nuclear DNA C-values for 25 angiosperm families. Annals of Botany 87: 251-258

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kondo, K. 1973. The karyotypes of the species of Byblis. Bull. Torrey Bot. Club 100: 367–369.

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Conran, J. G., A. Houben & A. Lowrie. 2002. Chromosome numbers in Byblidaceae. Austral. J. Bot. 50: 583–586.

n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Peng, C. i. & A. Kenton. 1982. Chromosome number of Byblis liniflora Salisb. (Byblidaceae). Ann. Missouri Bot. Gard. 69: 418–419.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type656 records

Wild obs. + sensor242

Museum / vouchered389

Cultivated / captive1

Other24

Origin

Native41

Range

Area of Occupancy AOO1 992 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 139≤1 km 8≤10 km 7>10 km 8

162 georeferenced · 80 without coordinates

Open the mapobservation + sensor242

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 117≤1 km 29≤10 km 152>10 km 17

315 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence389

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	104
Palmerston, AU	85
Kensington, AU	62
Canberra, AU	37
Mount Annan, AU	20
Adelaide, AU	19
Smithfield, AU	18
Museo Entomologico de Leonlocation not on record	16
BGPAlocation not on record	7
Kew, GB	6
James Cook Townsvillelocation not on record	4
South Kensington, GB	3
Bronx, US	1
Claremont, US	1
Saint Louis, US	1

15 institutions · 384 of 389 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Byblis liniflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)