Byblis filifolia

Planch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Byblidaceae/Byblis

At a glance

Occurrence records431

Data sources11

Biological traits18

DNA specimens6

eDNA detections6

Sources11 archives

Databases and archives Byblis filifolia's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility431 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF431 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Byblis filifolia is a species of plant in the Byblidaceae family. It is endemic to Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Plant height0.4 m

Plant height max0.6 m

Plant height min0.2 m

Seed mass0.062 mg

⚠ sources differ — TRY: 0.062 mg · AusTraits: 0.038 mg

Life cycle & reproduction5

Flowering timennyyyynnnnnn

Life formannual

Life spanannual

Raunkiær life formtherophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Byblis filifolia has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences6

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU810485.1 ↗636 bp

ACGT

TTGAAGTAAAAAGTTGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCGTGACCCTGAAAGGTAGACCCGAGCACTTTGT …

Byblis filifolia voucher BfilKF04 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Byblis filifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–322n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl · CCDB · Automatic manuscript search

CCDB · ipcn-api-dl — Conran, J. G., A. Houben & A. Lowrie. 2002. Chromosome numbers in Byblidaceae. Austral. J. Bot. 50: 583–586.

CCDB · Automatic manuscript search — K. Fukushima,Kaori Imamura,Katsuya Nagano and Y. Hoshi. 2010. "Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae)". Journal of Plant Research 124:231-244.

2n 321×CCDB · Automatic manuscript search

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type431 records

Wild obs. + sensor111

Museum / vouchered320

Origin

Native30

Range

Area of Occupancy AOO1 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 70≤1 km 11≤10 km 1>10 km 6

88 georeferenced · 23 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 79≤1 km 25≤10 km 134>10 km 13

251 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence320

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	162
Palmerston, AU	47
Canberra, AU	27
Museo Entomologico de Leonlocation not on record	24
Adelaide, AU	23
Brisbane, AU	18
Mount Annan, AU	11
Smithfield, AU	2
Armidale, AU	1
BGPAlocation not on record	1

10 institutions · 316 of 320 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Byblis filifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)