Buxus natalensis

(Oliv.) Hutch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Buxales/Buxaceae/Buxus

At a glance

Occurrence records149

Data sources7

Biological traits14

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Buxus natalensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility149 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS18 compounds

Occurrence & distributionGBIF149 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max5 m

Plant height min1 m

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 100 m

Elevation min5 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Buxus natalensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Steroidal alkaloids14

Simple phenolic acids2

Polyamines2

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Buxaminol C	present	LOTUS
(1R,3R,6S,8R,11S,12S,15E,16S)-6-(dimethylamino)-15-ethylidene-7,7,11,12,16-pentamethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-14-one	present	LOTUS
(alphaS,3S,3aR,9S,10aR,12aR,12bS)-9-(Dimethylamino)-1,2,3,3a,4,7,8,9,10,10a,11,12,12a,12b-tetradecahydro-N,N,alpha,3a,10,10,12b-heptamethylbenzo(4,5)cyclohept(1,2-e)indene-3-methanamine	present	LOTUS
31-Demethylbuxaminol	present	LOTUS
[(1S,3R,4S,6R,7S,8R,13R,16S,17S,20R)-16-benzamido-7-[(1R)-1-(dimethylamino)ethyl]-13-hydroxy-4,8,17-trimethyl-19-oxapentacyclo[11.6.1.03,11.04,8.017,20]icos-10-en-6-yl] acetate	present	LOTUS
[(3R,6S,7S,8S,11R,12S,14R,15S,16R)-6-[benzoyl(methyl)amino]-15-[(1S)-1-(dimethylamino)ethyl]-3-hydroxy-7-(hydroxymethyl)-7,12,16-trimethyl-14-tetracyclo[9.7.0.03,8.012,16]octadec-1(18)-enyl] acetate	present	LOTUS
[6-Benzamido-15-[1-(dimethylamino)ethyl]-3-hydroxy-7-(hydroxymethyl)-7,12,16-trimethyl-14-tetracyclo[9.7.0.03,8.012,16]octadeca-1(18),4-dienyl] acetate	present	LOTUS
Buxafuranamide	present	LOTUS
Buxalongifolamidine	present	LOTUS
Buxaminol A	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Buxus natalensis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF245425.1 ↗977 bp

ACGT

CCTGCCCTTTGTACACACCGCCCATCGCTCCTACCGCTTGAATGGTAAGGTGAAGTGTTCGGATCGTGGCCTGCGGGGGGTTTGCCGCCG …

Notobuxus natalensis 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type149 records

Wild obs. + sensor15

Museum / vouchered134

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 11≤1 km 2

13 georeferenced · 2 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 134 records without

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	74
Durban, ZA	53
Paris, FR	2
University of Johannesburglocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1

5 institutions · 131 of 134 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Buxus natalensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 16.6–17.4

Seasonal swing summer↔winter6.00 °C

Max temp (day)20.9 °C 20.6–21.1

Min temp (night)13.3 °C 12.5–14.1

Precipitation53.4 mm/mo 35.8–70.9

Air humidity57.1 % 53.3–60.9

Moisture balance-47.7 mm/mo -50.3–-45.1

Vapour deficit827 Pa 773–882

Wind speed3.20 m/s 3.00–3.30

Cloud cover15.0 % 9.30–20.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)