Buxus hildebrandtii

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Buxales/Buxaceae/Buxus

At a glance

Occurrence records167

Data sources8

Biological traits7

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Buxus hildebrandtii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility167 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS · NPASS104 compounds

Occurrence & distributionGBIF167 records

DNA & barcodingNCBIsequences

01Narrative

Buxus hildebrandtii is a species of shrub or small tree native to the Horn of Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition104 compounds

Compounds documented for Buxus hildebrandtii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eudesmane sesquiterpenoids21

Steroidal alkaloids14

Eremophilane sesquiterpenoids6

Cadinane sesquiterpenoids5

Unsaturated fatty acids4

Documented compounds104 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-(4R,5S,7R)-13-Hydroxynootkatone	present	NPASS
(+)-Nootkatone	present	NPASS
(1aR,4aR,7R,8aR)-7-hydroxy-1a,4a-dimethyl-7-prop-1-en-2-yl-4,5,6,8-tetrahydro-3H-naphtho[1,8a-b]oxiren-2-one	present	NPASS
(1aR,7R,7bS)-1a-methyl-7-propan-2-yl-2,3,5,6,7,7b-hexahydronaphtho[1,2-b]oxiren-4-one	present	NPASS
(1r,2r)-p-Menth-3-en-1,2-diol	present	NPASS
(1S,2S)-2-methyl-8-propan-2-yl-3,4-dihydro-1H-naphthalene-1,2,5-triol	present	NPASS
(1S,2S,6S,7R,8S)-1,5-dimethyl-8-propan-2-yltricyclo[4.4.0.02,7]dec-4-en-3-one	present	NPASS
(1S,4R,4aS,6R)-4,4a-dimethyl-6-prop-1-en-2-yl-2,3,4,5,6,7-hexahydro-1H-naphthalen-1-ol	present	NPASS
(1S,4R,4aS,6S,8aS)-4,8a-dimethyl-6-prop-1-en-2-yl-1,2,3,4a,5,6,7,8-octahydronaphthalene-1,4-diol	present	NPASS
(2R,4aS,7R,8aR)-4a-Methyl-1-methylidene-7-(prop-1-en-2-yl)decahydronaphthalen-2-ol	present	NPASS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Buxus hildebrandtii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF245415.1 ↗935 bp

ACGT

CCTGCACTTTGTACACACCACCTGTCGCTTCTACCGATTGAATGGTCTGATGAAGTGTTCGGACTACGGCTTGTGGGCAGTTCACCGCCA …

Buxus hildebrandtii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type167 records

Wild obs. + sensor77

Museum / vouchered90

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 22≤1 km 2≤10 km 1>10 km 3

28 georeferenced · 49 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	34
Kew, GB	21
Saint Louis, US	7
MeiseBGlocation not on record	4
Moscow State Universitylocation not on record	2
Stockholm, SE	2
Edinburgh, GB	2
Uppsala, SE	2
University of Hargeisalocation not on record	1
MAlocation not on record	1
Wlocation not on record	1
BClocation not on record	1
South Kensington, GB	1
Frankfurt am Main	1

14 institutions · 80 of 90 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)