Buxus harlandii

Hance · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Buxales/Buxaceae/Buxus

At a glance

Occurrence records176

Data sources11

Biological traits7

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Buxus harlandii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility176 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF176 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT1.4 Gbp

01Narrative

Buxus harlandii, the Harland boxwood, is a species of flowering plant in the family Buxaceae. It is native to coastal southeast China, from Hong Kong and other Guangdong islands down to Hainan, and to Vietnam. Care must be taken when purchasing, as many specimens labeled Buxus harlandii are actually Buxus microphylla.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height1 m

Life cycle & reproduction3

DeciduousnessEvergreen broad-leaved

Life formshrub

Life spanperennial

Habitat & environment2

Climatesubtropical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Buxus harlandii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF245410.1 ↗960 bp

ACGT

TTTTGTACACACCGCCCGTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGCGGCCTGTGGGCGGTTCGCCGCCGGCGAGT …

Buxus harlandii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Buxus harlandii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 388 760 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Buxus harlandii1.39 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidy4× tetraploid · measured

Chromosome records28–562n range56median56mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 562×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Van Laere K, Hermans D, Leus L, Van Huylenbroeck J. 2011. Genetic relationships in European and Asiatic Buxus species based on AFLP markers, genome sizes and chromosome numbers. Plant Systematics and Evolution 293: 1-11.

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Huang, S. f., Y. q. Wang, Z. y. Chen & X. h. Shi. 1988. Plant chromosome counts (4). Subtrop. Forest Sci. Technol. 16: 25–30.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type176 records

Wild obs. + sensor4

Museum / vouchered172

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 3

5 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	41
Guangzhou, CN	30
Guilin, CN	12
Hangzhou, CN	8
Yangling, CN	8
Nanjing, CN	8
Kunming, CN	7
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	4
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	4
Guangzhou, CN	4
Zhejiang Museum of Natural Historylocation not on record	4
Paris, FR	3
Chengdu, CN	3
Bangkok, TH	3
Chengdu, CN	2
Zhengzhou, CN	2
Wuhan, CN	2
Riverside, US	2
Central China Normal Universitylocation not on record	2
Taipei, TW	2
Seoul, KR	1
Shanxi Universitylocation not on record	1
Taipei, TW	1
SCAUlocation not on record	1
Edmonton, CA	1
TAIElocation not on record	1
Saint Louis, US	1
Shenzhen, CN	1
Zhejiang Universitylocation not on record	1
Jiujiang Forestry Institutelocation not on record	1
South Kensington, GB	1
Jiangxi College of Traditional Chinese Medicinelocation not on record	1
黔东南州民族医药研究所标本室location not on record	1
Taipei, TW	1
ASUlocation not on record	1
Strecker Museum, Baylor Universitylocation not on record	1
Xiamen, CN	1
Guizhou Forestry Schoollocation not on record	1
Chongqing Natural History Museumlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Guiyang, CN	1

41 institutions · 172 of 172 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Buxus harlandii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)