Buxus balearica

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Buxales/Buxaceae/Buxus

At a glance

Occurrence records715

Data sources14

Biological traits13

DNA specimens9

eDNA detections4

Sources14 archives

Databases and archives Buxus balearica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility715 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF715 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT768 Mbp

01Narrative

Buxus balearica, the Balearic boxwood, is a shrub or small evergreen tree typical of the Mediterranean forest. It grows wild in Algeria, Morocco, the Island of Sardinia and Spain.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height5 m

Seed mass7.45 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeself

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment4

Climatesubtropical

Elevation mean581 m

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)3.57 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition29 compounds

Compounds documented for Buxus balearica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Steroidal alkaloids25

Guaiane sesquiterpenoids5

Merohemiterpenoids1

Germacrane sesquiterpenoids1

Phenylethanoids1

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(1R)-1-(6-methoxy-2,2-dimethylchromen-5-yl)ethanol	present	NPASS
(1R)-1-[(2S)-5-methoxy-2-prop-1-en-2-yl-2,3-dihydro-1-benzofuran-4-yl]ethanol	present	NPASS
(1R,3R,6S,8R,11S,12S,14R,15S,16R)-6-(dimethylamino)-7,7,12,16-tetramethyl-15-[(1S)-1-(methylamino)ethyl]pentacyclo[9.7.0.01,3.03,8.012,16]octadec-4-en-14-ol	present	LOTUS
(1S,3R,6S,8R,11S,12S,15Z,16S)-15-ethylidene-12,16-dimethyl-6-(methylamino)-7-methylidenepentacyclo[9.7.0.01,3.03,8.012,16]octadecan-14-one	present	LOTUS
1-[(1S,3S,6S,11S,12S,16S)-7,7,12,16-tetramethyl-6-(methylamino)-15-pentacyclo[9.7.0.01,3.03,8.012,16]octadeca-8,14-dienyl]ethanone	present	LOTUS
1-[(6R,7S,10S,11R,14R,15R,20S)-6,10,15,19-tetramethyl-17-oxa-19-azapentacyclo[12.8.0.03,11.06,10.015,20]docosa-1,3-dien-7-yl]ethanone	present	LOTUS
1-[(6R,7S,10S,11R,14R,15S,20S)-6,10,15,19-tetramethyl-17-oxa-19-azapentacyclo[12.8.0.03,11.06,10.015,20]docosa-1,3-dien-7-yl]ethanone	present	LOTUS
15-[1-(dimethylamino)ethyl]-N,7,7,12,16-pentamethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-amine	present	LOTUS
6-(Dimethylamino)-7-(hydroxymethyl)-7,12,16-trimethyl-15-[1-(methylamino)ethyl]pentacyclo[9.7.0.01,3.03,8.012,16]octadec-9-en-14-ol	present	LOTUS
[(3aR,4R,6aR,9aR,9bR)-9-methyl-3,6-dimethylidene-2-oxo-4,5,6a,7,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] (5R)-5-hydroxy-2,5-dihydrofuran-3-carboxylate	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Buxus balearica has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences10

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMN537043.1 ↗344 bp

ACGT

GTTGCGCCCTAGGCCATACGGTCGAGGGCACGTCTGCCTGGGCGTCACGCGATGCGTGCCTCTCCCCTCCGACGCCCCGCCCCGGGCTTT …

Buxus balearica isolate B-622 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS5★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Buxus balearica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size767 730 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Buxus balearica0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy2× diploid · measured

Chromosome records28–282n range28median28mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 287×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · book-fedorov +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · book-fedorov — Simonet, Miedzyrzecki 1932

CCDB · book-atlas-flowering-plants — Simonet & M. 1932

CCDB · kew — Van Laere K, Hermans D, Leus L, Van Huylenbroeck J. 2011. Genetic relationships in European and Asiatic Buxus species based on AFLP markers, genome sizes and chromosome numbers. Plant Systematics and Evolution 293: 1-11.

CCDB · CromoCat 2015 — Simonet, M. & C. Miedzyrzecki. (1932). Étude caryologique de quelques espèces arborescentes ou sarmenteuses d'ornament. Compt. Rend. Hebd. Séances Mem. Soc. Biol. 111(40): 969-973.

CCDB · Automatic manuscript search — J. Rossell,A. Lzaro,R. Cosn and A. Molins. 2007. "A Phylogeographic Split in Buxus balearica (Buxaceae) as Evidenced by Nuclear Ribosomal Markers: When ITS Paralogues Are Welcome". Journal of Molecular Evolution 64:143-157.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type715 records

Wild obs. + sensor402

Museum / vouchered309

Cultivated / captive1

Other3

Range

Area of Occupancy AOO1 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 108≤1 km 63≤10 km 187>10 km 6

364 georeferenced · 38 without coordinates

Open the mapobservation + sensor402

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 11≤1 km 61≤10 km 33>10 km 1

106 georeferenced · 203 without coordinates

Open the institutions mapphysical evidence309

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	49
MAlocation not on record	37
College of the Atlantic, Museumlocation not on record	35
BClocation not on record	17
Barcelona, ES	16
València, ES	14
UIBlocation not on record	11
Granada, ES	10
Sevilla, ES	10
JBSlocation not on record	9
MeiseBGlocation not on record	9
Saint Louis, US	6
Phyletisches Museum Jenalocation not on record	5
Wlocation not on record	5
Jaén, ES	4
Alicante, ES	4
Pamplona, ES	4
Vitoria, ES	4
BIO-UNIPIlocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	3
University of Stellenboschlocation not on record	3
Salamanca, ES	3
San Sebastián, ES	3
Entomological Society of Latvialocation not on record	2
Badajoz, ES	2
Madrid, ES	2
Bronx, US	2
Madrid, ES	1
Museo Achille Folettolocation not on record	1
Christchurch, NZ	1
Canadian Department of Agriculturelocation not on record	1
BDBClocation not on record	1
Museo della Bonifica di San Donà di Piavelocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Córdoba, ES	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Henry Brockhouse Collectionlocation not on record	1
Berlin, DE	1
Uppsala, SE	1

39 institutions · 284 of 309 vouchered records shown · 24 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Buxus balearica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 13.6–14.4

Seasonal swing summer↔winter22.9 °C

Max temp (day)19.2 °C 18.9–19.4

Min temp (night)9.00 °C 8.70–9.20

Precipitation93.3 mm/mo 76.4–110

Air humidity56.4 % 54.9–57.9

Moisture balance-9.90 mm/mo -18.5–-1.30

Vapour deficit745 Pa 716–775

Wind speed3.30 m/s 2.70–3.90

Cloud cover42.7 % 41.2–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)