Bursera hindsiana

(Benth.) Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Burseraceae/Bursera

At a glance

Occurrence records573

Data sources6

Biological traits12

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Bursera hindsiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility573 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF573 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Bursera hindsiana là một loài thực vật có hoa trong họ Burseraceae. Loài này được (Benth.) Engl. mô tả khoa học đầu tiên năm 1883.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza type0.00000000908

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bursera hindsiana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSGQ378136.1 ↗661 bp

ACGT

CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGCGAACCGGTTATTAAAAACGT …

Bursera hindsiana voucher J. Nunez-Farfan sn internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type573 records

Wild obs. + sensor397

Museum / vouchered176

Range

Area of Occupancy AOO1 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 189≤1 km 36≤10 km 6>10 km 6

237 georeferenced · 160 without coordinates

Open the mapobservation + sensor397

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 2≤10 km 8>10 km 12

22 georeferenced · 154 without coordinates

Open the institutions mapphysical evidence176

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	85
ASUlocation not on record	20
Riverside, US	10
Phoenix, US	9
Saint Louis, US	7
Austin, US	5
University of Stellenboschlocation not on record	5
Bronx, US	4
Tampa, US	3
Claremont, US	3
EL PASO, US	2
Kew, GB	2
Wuzhou, CN	2
Flagstaff, US	2
US	1
Logan, US	1
Irvine, US	1
Chadron, US	1
San Jose, US	1
MEXUlocation not on record	1
The University of Arizonalocation not on record	1
USONlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1

23 institutions · 168 of 176 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Bursera hindsiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)