Bursaria spinosa

Cav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Pittosporaceae/Bursaria

At a glance

Occurrence records23 971

Data sources10

Biological traits46

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Bursaria spinosa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 971 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources46 traits

Chemical compositionNPASS158 compounds

Occurrence & distributionGBIF23 971 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Foliage Habit, subsp. lasiophylla Bursaria spinosa is a small tree or shrub in the family Pittosporaceae. The species occurs mainly in the eastern and southern half of Australia and not in Western Australia and the Northern Territory. Reaching 10 m (35 ft) high, it bears fragrant white flowers at any time of year but particularly in summer. A common understorey shrub of eucalyptus woodland, it colonises disturbed areas and fallow farmland. It is an important food plant for several species of butterflies and moths, particularly those of the genus Paralucia, and native bees.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology20

Fruit length6 mm

Fruit width7.5 mm

Leaf length35 mm

Leaf length max43 mm

Leaf length min20 mm

Leaf mass2 mg

Leaf mass per area96.0 g/m2

Leaf size36 mm²

⚠ sources differ — TRY: 36 mm² · AusTraits: 52.1 mm²

Leaf width5.45 mm

Leaf width max12 mm

Leaf width min3 mm

Petiole length0.125 cm

Plant height8 m

⚠ sources differ — AusTraits: 8 m · TRY: 2 m

Plant height max10 m

Plant height min0.5 m

Seed length3 mm

Seed mass1.48 mg

⚠ sources differ — TRY: 1.48 mg · AusTraits: 1.31 mg · GIFT: 1.36 mg

Seed mass max1.47 mg

Seed mass min1.26 mg

Seed width2 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typewind

Flowering timeyynnnnnnnnny

Life formshrub or tree

Life spanperennial

Lifespan years50 years

Pollination syndromeinsect

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_obovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.63 mm²/mg

Wood density725 mg/cm³

03Chemical composition158 compounds

Compounds documented for Bursaria spinosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones27

Carotenoids (C40, β-β)16

Limonoids9

Acyclic monoterpenoids8

Menthane monoterpenoids $ Monocyclic monoterpenoids7

Documented compounds158 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Thujene	present	NPASS
(+)-trans-Sabinene hydrate	present	NPASS
(-)-alpha-Pinene	present	NPASS
(-)-Linalool	present	NPASS
(-)-trans-Carveol	present	NPASS
(1R)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(1R,4S,6R)-4-hydroxy-2,2,6-trimethylcyclohexyl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol	present	NPASS
(1R,2R,7S,10R,13R,14R,16S,19R,20S)-19-[(2R)-2-hydroxy-5-oxo-2H-furan-3-yl]-9,9,13,20-tetramethyl-4,8,15,18-tetraoxahexacyclo[11.9.0.02,7.02,10.014,16.014,20]docosane-5,12,17-trione	present	NPASS
(1R,2R,7S,10S,13R,14R,16S,19S,20S)-19-(furan-3-yl)-9,9,13,20-tetramethyl-4,8,15,18-tetraoxahexacyclo[11.9.0.02,7.02,10.014,16.014,20]docosane-5,12,17-trione	present	NPASS
(1R,3S,6S)-6-[(3E,5E,7E,9E,11E,13E,15E,17E)-18-[(4R)-4-hydroxy-2,6,6-trimethylcyclohexen-1-yl]-3,7,12,16-tetramethyloctadeca-3,5,7,9,11,13,15,17-octaenyl]-1,5,5-trimethyl-7-oxabicyclo[4.1.0]heptan-3-ol	present	NPASS
(1S,2R,4S)-1-[(1E,3E,5E,7E,9E,11E,13E,15E)-16-[(2R,6S,7aR)-6-hydroxy-4,4,7a-trimethyl-2,5,6,7-tetrahydro-1-benzofuran-2-yl]-3,7,12-trimethylheptadeca-1,3,5,7,9,11,13,15-octaenyl]-2,6,6-trimethylcyclohexane-1,2,4-triol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bursaria spinosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY829024.1 ↗668 bp

ACGT

CTGCGGAAGGATCATTGTCGATGCCTGCACAGCAGAGCGACCAGCGAACTCGTTTAAACACGCAGGCCGGCGGCGACGGGGGCGACAGCC …

Bursaria spinosa internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type23 971 records

Wild obs. + sensor23 712

Museum / vouchered243

Cultivated / captive12

Fossil1

Other3

Origin

Native655

Introduced1

Range

Area of Occupancy AOO38 300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 17 972≤1 km 2 568≤10 km 566>10 km 337

21 443 georeferenced · 2 269 without coordinates

Open the mapobservation + sensor23 712

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 69≤1 km 32≤10 km 22>10 km 3

126 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence243

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 9 without coordinates

Open the mapnot free-living12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Armidale, AU	47
NSW Dept of Planning, Industry and Environmentlocation not on record	39
Mount Annan, AU	21
Canberra, AU	10
Batemans Bay, AU	10
Museo Entomologico de Leonlocation not on record	10
QVMAGlocation not on record	9
Kew, GB	9
Adelaide, AU	8
Parkville, AU	8
La Trobe Universitylocation not on record	7
Brisbane, AU	6
Wellington, NZ	4
Hobart, AU	3
John T. Waterhouse Herbariumlocation not on record	3
Riverside, US	3
James Cook Townsvillelocation not on record	3
Zürich, CH	3
MeiseBGlocation not on record	3
Smithfield, AU	3
Stockholm, SE	3
Tampa, US	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Guangzhou, CN	2
NSW Office of Environment and Heritagelocation not on record	1
Kensington, AU	1
Uniwersytet Jagiellońskilocation not on record	1
Rotorua, NZ	1
Canadian Department of Agriculturelocation not on record	1
Auckland, NZ	1
University of Stellenboschlocation not on record	1
US	1
Cambridge University Herbariumlocation not on record	1
EL PASO, US	1
Davis, US	1

35 institutions · 229 of 243 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Bursaria spinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Bursaria spinosa

At a glance

Sources10 archives

Size & morphology20

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Compound class profile5 classes

Documented compounds158 total

At a glance

Record type23 971 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type23 971 records