Burretiodendron hsienmu

Chun & F.C.How · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Burretiodendron

At a glance

Occurrence records40

Data sources7

Biological traits17

DNA specimens0

eDNA detections6

Sources7 archives

Databases and archives Burretiodendron hsienmu's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources17 traits

Occurrence & distributionGBIF40 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingNCBIsequences

01Narrative

Burretiodendron tonkinense is a species of flowering plant in the family Malvaceae. It is found in China and Vietnam. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology4

Fruit length37.5 mm

Fruit length max40 mm

Fruit length min35 mm

Plant height35 m

⚠ sources differ — GIFT: 35 m · TRY: 16 m

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf n16.4 mg/g

Leaf p1.46 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density926 mg/cm³

⚠ sources differ — TRY: 926 mg/cm³ · GIFT: 1 130 mg/cm³

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Burretiodendron hsienmu has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR199718.1 ↗458 bpChina

ACGT

GAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACG …

Excentrodendron hsienmu voucher PX034 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type40 records

Museum / vouchered40

Range

Area of Occupancy AOO68 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 40 records without

Open the institutions mapphysical evidence40

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	17
Guilin, CN	9
Guangxi Agricultural Universitylocation not on record	4
Saint Louis, US	3
Beijing, CN	1
Kunming, CN	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Moscow State Universitylocation not on record	1
Nanjing, CN	1

9 institutions · 38 of 40 vouchered records shown · 2 without an institution code

09Environmental DNA6 detections

Where the DNA of Burretiodendron hsienmu was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 15.8–15.8

Seasonal swing summer↔winter17.7 °C

Max temp (day)18.5 °C

Min temp (night)11.9 °C

Precipitation378 mm/mo

Air humidity70.4 %

Moisture balance284 mm/mo

Vapour deficit529 Pa

Wind speed3.70 m/s

Cloud cover53.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)