Burnettia cuneata

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Burnettia

At a glance

Occurrence records470

Data sources5

Biological traits25

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Burnettia cuneata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility470 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF470 records

DNA & barcodingNCBIsequences

01Narrative

Burnettia cuneata, commonly known as the lizard orchid, is the only species of the flowering plant genus Burnettia in the orchid family, Orchidaceae. It is a leafless terrestrial, mycotrophic herb with one or two leaf-like bracts and up to seven flowers that are brownish on the back and pink or white inside. It is endemic to southeastern Australia where it grows in dense thickets in swamps.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology3

Plant height0.09 m

Plant height max0.13 m

Plant height min0.05 m

Life cycle & reproduction10

Dispersal typewind

Flowering endDec

Flowering startSep

Flowering timennnnnnnnyyyy

Life spanperennial

Lifespan years3 years

Pollination syndromeinsect

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: holo-Mycoheterotroph · GIFT: independent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Burnettia cuneata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF347985.1 ↗690 bp

ACGT

ATCATTGTCGAGACCCGAAAGAGACCGAATAAGCTTGACAACCTGTGAATTAATCAATGGAGGAGGCCGCGGAAGCTGACGCCGCCGATC …

Burnettia cuneata 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type470 records

Wild obs. + sensor270

Museum / vouchered198

Cultivated / captive2

Origin

Native15

Range

Area of Occupancy AOO1 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 131≤1 km 57≤10 km 64>10 km 6

258 georeferenced · 12 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 5≤1 km 63≤10 km 95>10 km 14

177 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence198

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	65
Canberra, AU	60
Hobart, AU	26
Mount Annan, AU	15
Adelaide, AU	14
NSW Dept of Planning, Industry and Environmentlocation not on record	10
QVMAGlocation not on record	5
Parkville, AU	2
Smithfield, AU	1

9 institutions · 198 of 198 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)