Burmannia biflora

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Dioscoreales/Burmanniaceae/Burmannia

At a glance

Occurrence records332

Data sources8

Biological traits10

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Burmannia biflora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility332 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF332 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Burmannia biflora, common name northern bluethread, is a plant species native to Cuba, the Bahamas and to the southeastern United States. It has been reported from Puerto Rico, eastern Texas, Louisiana, southwestern Arkansas (Hempstead County), southern Mississippi, southern Alabama, Florida, Georgia, South Carolina, North Carolina and southeastern Virginia.BONAP (Biota of North America Program) floristic synthesis, Burmannia bifloraMaas, P. J. M., H. Maas van de Kamer, J. v. Benthem, H. C. M. Snelders & T. Rübsamen. 1986. Burmanniaceae. Flora Neotropica 42: 1–189. Burmannia biflora grows in wet areas (bogs, swamps, ditches, lake shores, etc.) at elevations less than 100 m. It is an annual herb up to 20 cm tall. Flowers are borne in a loose cyme of up to 12 flowers, blue, 3-winged, sometimes white around the edges.Radford, A. E., H. E. Ahles & C. R. Bell. 1968. Manual of the Vascular Flora of the Carolinas i–lxi, 1–1183. University of North Carolina Press, Chapel Hill.Long, R. W. & O. K. Lakela. 1971. Flora of Tropical Florida: A Manual of the Seed Plants and Ferns of Southern Peninsular Florida i–xvii, 1–962. Coral Gables: University of Miami Press.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Burmannia biflora has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU816751.1 ↗801 bpUSA

ACGT

ACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACACGAGGACAGATGA …

Burmannia biflora voucher Chase 157 (NCU) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS1

plant barcodefungal barcode

07Deep time~22.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin22.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type332 records

Wild obs. + sensor209

Museum / vouchered123

Range

Area of Occupancy AOO980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 85≤1 km 14≤10 km 5>10 km 74

178 georeferenced · 31 without coordinates

Open the mapobservation + sensor209

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 5≤1 km 20≤10 km 25>10 km 14

64 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	19
Chapel Hill, US	13
Miami, US	11
GAlocation not on record	8
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Fort Worth, US	5
Bangkok, TH	5
Jena Microbial Resource Collectionlocation not on record	5
US	4
Valdosta State Universitylocation not on record	4
Austin, US	3
Chongqing Museumlocation not on record	3
Saint Louis, US	3
University of Stellenboschlocation not on record	2
Tuscaloosa, US	2
Jackson, US	2
Dekalb, US	2
Millersville, US	2
Phoenix, US	2
Little Rock, US	2
Philadelphia, US	2
Bronx, US	1
Paris, FR	1
Flagstaff, US	1
Knoxville, US	1
Missoula, US	1
Norfolk, US	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
University of Southern Mississippilocation not on record	1
Weymouth Woods Sandhills Nature Preservelocation not on record	1
Auckland, NZ	1
Riverside, US	1
Tall Timbers Research Stationlocation not on record	1
Chadron, US	1
Mississippi State, US	1
Clemson, US	1
Bloomington, US	1
ASUlocation not on record	1

38 institutions · 121 of 123 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Burmannia biflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)