Bupleurum handiense

(Bolle) G.Kunkel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Bupleurum

At a glance

Occurrence records47

Data sources9

Biological traits18

DNA specimens0

eDNA detections2

Sources9 archives

Databases and archives Bupleurum handiense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources18 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 32

01Narrative

Bupleurum handiense là một loài thực vật có hoa trong họ Hoa tán. Loài này được (Bolle) G.Kunkel mô tả khoa học đầu tiên năm 1976.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology4

Leaf length max60 mm

Leaf length min30 mm

Plant height max1 m

Plant height min0.5 m

Life cycle & reproduction5

Flower colouryellow

Flowering endAug

Flowering startMay

Life formsubshrub or shrub

Life spanperennial

Habitat & environment7

Climatesubtropical

Elevation max600 m

Elevation min550 m

Fruit colourblack

Growth formshrub

Leaf formelliptic

Woodinesswoody

Other traits2

Inflorescenceumbel

Leaf arrangementalternate

03Chemical composition1 compounds

Compounds documented for Bupleurum handiense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Arylnaphthalene and aryltetralin lignans1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Chinensin		present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bupleurum handiense has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON064046.1 ↗602 bp

ACGT

TCGAATCCTGAATCGAAGAACGACCCGAGAACATGTTTCAAGACAGGGCCAGCGGTCGTCGGTCCCGGCCGGTCGACTGCGAACCCTAGG …

Bupleurum canescens var. handiense voucher Herbier J.-P.Reduron J.-P.Reduron s.n. internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Bupleurum handiense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Cauwet-Marc 1976

CCDB · book-ipcn75-78 — Cauwet-Marc 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type47 records

Wild obs. + sensor47

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 36>10 km 8

45 georeferenced · 2 without coordinates

Open the mapobservation + sensor47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA2 detections

Where the DNA of Bupleurum handiense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa 953–953

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)