Bulbostylis capillaris
(L.) Kunth ex C.B.Clarke · speciesAt a glance
Occurrence records4 447
Data sources11
Biological traits28
DNA specimens6
eDNA detections4
Sources11 archives
Databases and archives Bulbostylis capillaris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 447 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics6 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources28 traits
Occurrence & distributionGBIF4 447 records
Environmental DNA1 datasets · 1 countries4 detections
DNA & barcodingBOLD · NCBI6 specimens
Genome at a glanceCCDB · GIFT2n = 72
01Narrative
Bulbostylis capillaris est une espèce de plantes de la famille des Cyperaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology11
Fruit length max1 mm
Fruit length min0.8 mm
Leaf length max100 mm
Leaf length min20 mm
Leaf width max0.6 mm
Leaf width min0.3 mm
Plant height max0.3 m
Plant height min0.03 m
Seed mass0.088 mg
Seed mass max0.09 mg
Seed mass min0.08 mg
Life cycle & reproduction4
Dehiscenceindehiscent
Life formannual or perennial
Life spanannual
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 180 m
Elevation mean1 400 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica, Cerrado (lato sensu), Floresta Ombrófila (= Floresta Pluvial), Restinga, Savana Amazônica, Vegetação Sobre Afloramentos Rochosos
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3-C4
⚠ sources differ — TRY: C3/C4 · GIFT: C3
05DNA & barcoding6 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbostylis capillaris has left across the world's sequence archives.
At a glance
DNA specimens6
Marker genes5
GenBank sequences8
eDNA detections4
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTAAGAAG …
Bulbostylis capillaris voucher CCDB-18345-C2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Bulbostylis capillaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 72 n = 36
Chromosome records72–842n range78median72mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 722×CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Sharma, B.R. 1962
GIFT · GIFT (floras)
2n 842×CCDB · eflora · CCDB · book-atlas-flowering-plants
CCDB · eflora
CCDB · book-atlas-flowering-plants
n 362×CCDB · cyper-only · CCDB · Cave1962
CCDB · cyper-only — Sharma, B. R.1962
CCDB · Cave1962 — Sharma 1962
08Occurrence & distribution
Record type4 447 records
Wild obs. + sensor545
Museum / vouchered3 888
Other14
Origin
Native498
Range
Area of Occupancy AOO11 496 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy78% within 1 km
≤100 m 277≤1 km 26≤10 km 9>10 km 77
389 georeferenced · 156 without coordinates
Open the mapobservation + sensor545
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 152≤1 km 492≤10 km 764>10 km 100
1 508 georeferenced · 2 380 without coordinates
Open the institutions mapphysical evidence3 888
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions154 of 282 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 284 |
| Bronx, US | 253 |
| Chongqing Museumlocation not on record | 110 |
| Université de Bordeauxlocation not on record | 109 |
| Chapel Hill, US | 102 |
| Saint Louis, US | 100 |
| Jackson, US | 87 |
| Guasave, MX | 84 |
| Porto Alegre, BR | 83 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 80 |
| Madison, US | 68 |
| Austin, US | 63 |
| Masindi, UG | 60 |
| Bloomington, US | 59 |
| University of New Hampshirelocation not on record | 58 |
| University of Stellenboschlocation not on record | 56 |
| Ann Arbor, US | 54 |
| Universidade Federal de Sergipe (UFS)location not on record | 53 |
| Wuzhou, CN | 51 |
| ASUlocation not on record | 50 |
| Burlington, US | 49 |
| Allentown, US | 44 |
| Kew, GB | 43 |
| Longwood Universitylocation not on record | 40 |
| UFPElocation not on record | 40 |
| Laboratorio de Ictiologialocation not on record | 38 |
| Acadia Universitylocation not on record | 35 |
| Bangkok, TH | 35 |
| Altos de Pipe, VE | 34 |
| UnBlocation not on record | 34 |
| Flagstaff, US | 32 |
| Salvador, BR | 31 |
| Durango, MX | 31 |
| Williamsburg, US | 30 |
| USP-IBlocation not on record | 28 |
| St. Paul, US | 27 |
| CEPLAClocation not on record | 25 |
| Fort Worth, US | 25 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 23 |
| New Haven, US | 22 |
| College Park, US | 22 |
| Mexico City, MX | 21 |
| UNICAMPlocation not on record | 20 |
| Saint John, CA | 20 |
| UFESlocation not on record | 18 |
| INMAlocation not on record | 18 |
| Departamento de Sistematica e Ecologialocation not on record | 17 |
| JBRJlocation not on record | 17 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 17 |
| Feira de Santana, BR | 17 |
| San Angelo, US | 17 |
| UFBAlocation not on record | 17 |
| Keene State Universitylocation not on record | 17 |
| UFSClocation not on record | 16 |
| UFMGlocation not on record | 16 |
| Federal University of Espírito Santolocation not on record | 15 |
| Universidade Federal de Santa Catarinalocation not on record | 15 |
| Brasília, BR | 15 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 15 |
| PUC-RSlocation not on record | 14 |
| Chadron, US | 14 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 14 |
| IPA/SPlocation not on record | 14 |
| Paris, FR | 13 |
| Cenargenlocation not on record | 12 |
| Québec, CA | 12 |
| Phoenix, US | 12 |
| Toronto, CA | 12 |
| Universidade Federale do Rio Grande do Sullocation not on record | 11 |
| Little Rock, US | 11 |
| EL PASO, US | 11 |
| Western Carolina Universitylocation not on record | 11 |
| Chaguaramas, TT | 11 |
| Valdosta State Universitylocation not on record | 11 |
| Lincoln, US | 11 |
| Staten Island, US | 11 |
| Durham, US | 10 |
| Philadelphia, US | 10 |
| UFRPElocation not on record | 10 |
| Xiamen, CN | 10 |
| BAYLUlocation not on record | 9 |
| Buenos Aires, AR | 9 |
| Brasília, BR | 9 |
| Clemson, US | 9 |
| Universidade de Passo Fundolocation not on record | 9 |
| Tampa, US | 9 |
| Pullman, US | 8 |
| GAlocation not on record | 8 |
| Riverside, US | 8 |
| Montréal, CA | 8 |
| Millersville, US | 8 |
| UTFPR-CPlocation not on record | 8 |
| Taipei, TW | 8 |
| Santa Teresa, BR | 8 |
| La Paz, BO | 8 |
| Texas Lutheran Universitylocation not on record | 8 |
| Tuscaloosa, US | 8 |
| FPMZBlocation not on record | 7 |
| Mississippi State, US | 7 |
| Bogotá, D.C., CO | 7 |
| Museu Paraense Emílio Goeldilocation not on record | 7 |
| Albuquerque, US | 7 |
| UESBlocation not on record | 7 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 7 |
| FUVATESlocation not on record | 7 |
| Puebla, MX | 7 |
| Columbia, US | 7 |
| New Brunswick, US | 6 |
| Fayetteville, US | 6 |
| Wlocation not on record | 6 |
| South Kensington, GB | 6 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 6 |
| Claremont, US | 6 |
| San Diego, US | 6 |
| Jataí / Setor Industrial, BR | 6 |
| Campo Mourão, BR | 6 |
| Yaoundé, CM | 6 |
| Aarhus, DK | 6 |
| Knoxville, US | 6 |
| UNESP-RClocation not on record | 5 |
| UNIVASFlocation not on record | 5 |
| Auckland, NZ | 5 |
| Davis, US | 5 |
| Ciudad de México, MX | 5 |
| International Salmonella Centre (W.H.O.)location not on record | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| HUENFlocation not on record | 5 |
| Christchurch, NZ | 5 |
| Loja, EC | 5 |
| Universidade Federal do Espírito Santolocation not on record | 4 |
| Dekalb, US | 4 |
| Blumenau, BR | 4 |
| Universidade Federal do Maranhãolocation not on record | 4 |
| Dover, US | 4 |
| UFERSAlocation not on record | 4 |
| Maryland Department of Natural Resourceslocation not on record | 4 |
| Denver, US | 4 |
| Wellington, NZ | 4 |
| Cruz das Almas, BR | 4 |
| Davenport, US | 4 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 4 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 4 |
| Santarém, BR | 4 |
| Chicago, US | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| UFMSlocation not on record | 4 |
| WTUlocation not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| Corrientes, AR | 4 |
| Chicago, US | 4 |
| CJBGlocation not on record | 3 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 3 |
| San Isidro, AR | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| Universidad Nacional de Asunciónlocation not on record | 3 |
| UFSJlocation not on record | 3 |
| Lubbock, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Uberlândia, BR | 3 |
| Santa Barbara, US | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| Universidade Federal de Goiáslocation not on record | 3 |
| Cuiabá, BR | 3 |
| Vancouver, CA | 3 |
| Londrina, BR | 3 |
| Maringá, BR | 3 |
| CASlocation not on record | 3 |
| Cambridge, US | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Pittsburg, US | 3 |
| Kingston, US | 3 |
| US | 3 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Hermosillo, MX | 2 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| USFSlocation not on record | 2 |
| Moscow, US | 2 |
| GB | 2 |
| Guangzhou, CN | 2 |
| Chapingo, MX | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Museum of Zoologylocation not on record | 2 |
| UEMAlocation not on record | 2 |
| BISHlocation not on record | 2 |
| AUAlocation not on record | 2 |
| Olocation not on record | 2 |
| UNESClocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| UFOPlocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Université Lavallocation not on record | 2 |
| Universidade Federal de Juiz de Foralocation not on record | 2 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| Sucre, BO | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Criciúma, BR | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| MAlocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Honolulu, US | 2 |
| Lake Charles, US | 2 |
| Zacatecas, MX | 2 |
| Asheville, US | 2 |
| Ciudad de México, MX | 2 |
| Berlin, DE | 2 |
| HACAMlocation not on record | 2 |
| Chengdu, CN | 2 |
| UDESC-CAVlocation not on record | 1 |
| BClocation not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Fortaleza, BR | 1 |
| León, NI | 1 |
| MEXUlocation not on record | 1 |
| Wuhan, CN | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Campo Grande, BR | 1 |
| Minia, EG | 1 |
| Taipei, TW | 1 |
| Green Bay, US | 1 |
| Corvallis, US | 1 |
| Managua, NI | 1 |
| UNITINSlocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| US | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Logan, US | 1 |
| UNICAPlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Whitewater, US | 1 |
| Fairfax, US | 1 |
| Emporia, US | 1 |
| Quito, EC | 1 |
| LINUlocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Dresden, DE | 1 |
| Tempe, US | 1 |
| Ilhéus, BR | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Boise, US | 1 |
| St. Augustine, TT | 1 |
| Provo, US | 1 |
| Córdoba, AR | 1 |
| Cochabamba, BO | 1 |
| US | 1 |
| Elikins, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Seropédica, BR | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Whitehorse, CA | 1 |
| IAPlocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| UEGlocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Pelotas, BR | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Angwin, US | 1 |
| Universidade de São Paulolocation not on record | 1 |
| UFAClocation not on record | 1 |
| Miami, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Edinburgh, GB | 1 |
| ESALQlocation not on record | 1 |
| Teresina, BR | 1 |
| Stockholm, SE | 1 |
| Due West, US | 1 |
| UNESP-FCAlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Guangzhou, CN | 1 |
| Castelar, AR | 1 |
282 institutions · 3 741 of 3 888 vouchered records shown · 147 without an institution code
09Environmental DNA4 detections
Where the DNA of Bulbostylis capillaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 15.2–15.2
Seasonal swing summer↔winter21.6 °C
Max temp (day)19.6 °C
Min temp (night)12.4 °C
Precipitation114 mm/mo
Air humidity63.2 %
Moisture balance32.4 mm/mo
Vapour deficit634 Pa
Wind speed2.00 m/s
Cloud cover35.8 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.