Bulbostylis barbata
(Rottb.) C.B.Clarke · speciesAt a glance
Occurrence records5 934
Data sources10
Biological traits40
DNA specimens8
eDNA detections7
Sources10 archives
Databases and archives Bulbostylis barbata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 934 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics8 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources40 traits
Chemical compositionLOTUS10 compounds
Occurrence & distributionGBIF5 934 records
Environmental DNA1 datasets · 1 countries7 detections
DNA & barcodingBOLD · NCBI8 specimens
Genome at a glanceCCDB2n = 10
01Narrative
ハタガヤはカヤツリグサ科の植物の1つ。小柄な1年草で、束になって生じる茎の先端に多数の小穂を頭状に生じる。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology14
Fruit length0.65 mm
Fruit width0.4 mm
Leaf length max0.3 mm
Leaf length min0.25 mm
Leaf width0.25 mm
Leaf width max0.3 mm
Leaf width min0.25 mm
Plant height0.2 m
Plant height max0.5 m
Plant height min0 m
Seed length0.6 mm
Seed mass0.05 mg
⚠ sources differ — TRY: 0.05 mg · AusTraits: 0.06 mg · GIFT: 0.047 mg
Seed mass max0.07 mg
Seed mass min0.03 mg
Life cycle & reproduction9
Dehiscenceindehiscent
Dispersal typewind
Flowering timeyynnnnnnyyyy
Life formannual
Life spanannual
Pollination syndromewind
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typegynomonoecious
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max600 m
Elevation min100 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb
Habitat GIFTdry forest, Savanna
Leaf compoundnesssimple
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Other traits1
Plant support typefree-standing
03Chemical composition10 compounds
Compounds documented for Bulbostylis barbata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Noreudesmane sesquiterpenoids3
Aromatic polyketides with side chains1
Flavones1
Flavonols1
Aurones1
Documented compounds10 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione | present | LOTUS | |
| 2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| 3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione | present | LOTUS | |
| 5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| Aureusidin | present | LOTUS | |
| BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)- | present | LOTUS | |
| Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl- | present | LOTUS | |
| Cyperaquinone | present | LOTUS | |
| Quercetin | present | LOTUS | |
| Tricin | present | LOTUS |
05DNA & barcoding8 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbostylis barbata has left across the world's sequence archives.
At a glance
DNA specimens8
Marker genes4
GenBank sequences10
eDNA detections7
Countries4
The DNA barcodea real sequence read deposited for this species
CTGTCTCTTCTTTGAGAAAACAACCAGCGCACATGTAATGCAAAGCCGTCGAGGAGTTTTCTGCTCGACCCCACCGGCCCCGGCCTTCTA …
Bulbostylis barbata internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Bulbostylis barbata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Chromosome records10–102n range10median10mode15records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1015×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +5
CCDB · cyper-only — Tanaka, N.1941
CCDB · cyper-only — 12Nijalingappa, B. H. M.1972
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1975b
CCDB · cyper-only — 12Nijalingappa, B. H. M.1975a
CCDB · ipcn-api-dl — Ramachandran, K. & G. Jeeja. 1986. Cytology of Bulbostylis Kunth (Cyperaceae). Nucleus (Calcutta) 29: 48–50.
CCDB · ipcn-api-dl — Nijalingappa, B. H. M. 1975. Cytological studies in Fimbristylis (Cyperaceae). Cytologia 40: 177–183.
CCDB · book-ipcn72 — NIJALINGAPPA, B.H.M. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn75-78 — Nijalingappa 1975
CCDB · book-indian_vol2 — Tanaka, N. 1941 ; Mehra, P.N. & Sachdeva, S.K. 1975a ; Rath, S.P. & Patnaik, S.N. 1975
CCDB · book-indian_vol2 — Kral, R. 1971 ; Rath, S.P. & Pat- naik, S.N. 1978a
CCDB · book-indian_vol2 — Nijalingappa, B.H.M. 1972, 1975a
CCDB · eflora
CCDB · book-fedorov — Tanaka N. 194ia
CCDB · book-fedorov — D. 1965)
CCDB · book-atlas-flowering-plants — Tanaka 1941
n 516×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · cyper-only — Kral, R.1971
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1975
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978a
CCDB · cyper-only — Bir, S. S., M. K. Sidhu & S. Kamra1986
CCDB · cyper-only — Bir, S. S., S. Kamra, M. K. Sidhu & P. Cheema1988b
CCDB · cyper-only — Bir, S. S., P. Cheema & M. K. Sidhu1990
CCDB · cyper-only — Bir, S. S., G. S. Chatha & M. K. Sidhu.1992a
CCDB · ipcn-api-dl — Ramachandran, K. & G. Jeeja. 1986. Cytology of Bulbostylis Kunth (Cyperaceae). Nucleus (Calcutta) 29: 48–50.
CCDB · ipcn-api-dl — Bir, S. S., S. Kamra, M. Sidhu & P. Cheema. 1988. Cytomorphological studies on some members of Cyperaceae from north India. J. Cytol. Genet. 23: 14–37.
CCDB · ipcn-api-dl — Bir, S. S., P. Cheema & M. Sidhu. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 137–139.
CCDB · ipcn-api-dl — Bir, S. S., G. S. Chatha & M. Sidhu. 1992. Intraspecific variation in Cyperaceae from Punjab Plain, India. Willdenowia 22: 133–142.
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1978. Cytological studies in Cyperaceae with special reference to its taxonomy II. Cytologia 43: 643–653.
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1975. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. 62: 127–128.
CCDB · book-ipcn67-71 — KRAL, R. 1971. A treatment of Abildgardia, Bulbostylis, and Fimbristylis for North America. Sida 4: 57-227.
CCDB · book-ipcn75-78 — Rath & Patnaik 1975
CCDB · book-ipcn75-78 — Rath & Patnaik 1978
n 342×CCDB · cyper-only · CCDB · ipcn-api-dl
CCDB · cyper-only — Bir, S. S., P. Cheema & M. K. Sidhu & S. Kumari1993
CCDB · ipcn-api-dl — Bir, S. S., P. Cheema, M. Sidhu & S. Kumari. 1993. Karyomorphology of members of Bulbostylis Kunth and Scirpus Linn. from Punjab State, north India. Proc. Indian Natl. Sci. Acad., B 59: 147–151.
08Occurrence & distribution
Record type5 934 records
Wild obs. + sensor2 679
Museum / vouchered2 986
Other269
Origin
Native357
Introduced1
Range
Area of Occupancy AOO15 816 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 1 251≤1 km 50≤10 km 141>10 km 45
1 487 georeferenced · 1 192 without coordinates
Open the mapobservation + sensor2 679
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 473≤1 km 228≤10 km 743>10 km 218
1 662 georeferenced · 1 324 without coordinates
Open the institutions mapphysical evidence2 986
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions80 of 147 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 469 |
| Palmerston, AU | 318 |
| Kensington, AU | 250 |
| Mount Annan, AU | 204 |
| Canberra, AU | 148 |
| Guangzhou, CN | 108 |
| Kew, GB | 96 |
| Museo Entomologico de Leonlocation not on record | 95 |
| Tampa, US | 80 |
| Adelaide, AU | 68 |
| Jackson, US | 66 |
| Jena Microbial Resource Collectionlocation not on record | 63 |
| NSMKlocation not on record | 60 |
| Smithfield, AU | 56 |
| Armidale, AU | 43 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 24 |
| Saint Louis, US | 24 |
| Valdosta State Universitylocation not on record | 24 |
| Miami, US | 21 |
| Chapel Hill, US | 20 |
| Xiamen, CN | 18 |
| Guilin, CN | 17 |
| University of Stellenboschlocation not on record | 17 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 17 |
| Taipei, TW | 17 |
| HNBlocation not on record | 16 |
| MeiseBGlocation not on record | 16 |
| Paris, FR | 15 |
| Bronx, US | 14 |
| Baroda, IN | 14 |
| Guangzhou, CN | 13 |
| TAIElocation not on record | 13 |
| Bangkok, TH | 13 |
| Columbia, US | 12 |
| James Cook Townsvillelocation not on record | 11 |
| Knoxville, US | 10 |
| Kunming, CN | 10 |
| EL PASO, US | 10 |
| Hangzhou, CN | 10 |
| Frankfurt am Main | 9 |
| Université du Lomélocation not on record | 9 |
| Tuscaloosa, US | 9 |
| Tall Timbers Research Stationlocation not on record | 9 |
| AUAlocation not on record | 8 |
| Nanjing, CN | 8 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 8 |
| South Kensington, GB | 7 |
| Beijing, CN | 7 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 7 |
| US | 7 |
| GAlocation not on record | 7 |
| Sanda, JP | 7 |
| Chongqing Museumlocation not on record | 6 |
| BAYLUlocation not on record | 6 |
| Zhengzhou, CN | 6 |
| San Angelo, US | 6 |
| Shanghai, CN | 5 |
| National Marine Biodiversity Institute of Korealocation not on record | 5 |
| KR | 5 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Durham, US | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| UFMGlocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Clemson, US | 4 |
| Taipei, TW | 4 |
| Auckland, NZ | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| Riverside, US | 4 |
| Edinburgh, GB | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Mississippi State, US | 3 |
| Claremont, US | 3 |
| Uppsala, SE | 3 |
| CNF-UFHBlocation not on record | 3 |
| National Museums of Kenyalocation not on record | 3 |
| DNSMlocation not on record | 3 |
| Burlington, US | 3 |
| Christchurch, NZ | 3 |
| ASUlocation not on record | 3 |
| Kyoto Universitylocation not on record | 3 |
| Hobart, AU | 3 |
| Central China Normal Universitylocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Seychelles National Herbariumlocation not on record | 2 |
| ifplocation not on record | 2 |
| SCAUlocation not on record | 2 |
| Olocation not on record | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| LSFlocation not on record | 2 |
| Plocation not on record | 2 |
| Wuhan, CN | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Dover, US | 2 |
| Ann Arbor, US | 2 |
| Honolulu, US | 2 |
| Taipei, TW | 2 |
| Philadelphia, US | 2 |
| Fort Worth, US | 2 |
| Dekalb, US | 2 |
| Kagoshima, JP | 2 |
| Bloomington, US | 2 |
| Pretoria, ZA | 1 |
| Yangling, CN | 1 |
| Berlin, DE | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| BGPAlocation not on record | 1 |
| Dehra Dun, IN | 1 |
| UFVJMlocation not on record | 1 |
| WTUlocation not on record | 1 |
| Glocation not on record | 1 |
| UnBlocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| Wlocation not on record | 1 |
| Cincinnati, US | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| EFGlocation not on record | 1 |
| Minia, EG | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| FJIDClocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Pullman, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| Peking Universitylocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| León, NI | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Flagstaff, US | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| Awka, NG | 1 |
| Shanghai, CN | 1 |
| Seoul, KR | 1 |
| Changsha, CN | 1 |
| Weber State Universitylocation not on record | 1 |
| Chengdu, CN | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Yaoundé, CM | 1 |
| LBVlocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Norfolk, US | 1 |
| Wuhan, CN | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
147 institutions · 2 814 of 2 986 vouchered records shown · 170 without an institution code
09Environmental DNA7 detections
Where the DNA of Bulbostylis barbata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 12.6–12.6
Seasonal swing summer↔winter27.3 °C
Max temp (day)16.4 °C
Min temp (night)7.40 °C
Precipitation112 mm/mo
Air humidity58.0 %
Moisture balance21.7 mm/mo
Vapour deficit690 Pa
Wind speed2.90 m/s
Cloud cover41.1 %
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.