Bulbophyllum wendlandianum

(Kraenzl.) Dammer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Bulbophyllum

At a glance

Occurrence records7

Data sources7

Biological traits6

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Bulbophyllum wendlandianum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionLOTUS23 compounds

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Bulbophyllum wendlandianum é uma espécie de orquídea pertencente ao gênero Bulbophyllum. Foi descrita por Friedrich Fritz Wilhelm Ludwig Kraenzlin e Carl Lebrecht Udo Dammer em 1912.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

03Chemical composition23 compounds

Compounds documented for Bulbophyllum wendlandianum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenanthrenes5

Monomeric stilbenes5

Wax monoesters2

Shikimic acids and derivatives $ Simple phenolic acids2

Cholestane steroids $ Ergostane steroids1

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	LOTUS
(E)-3-Dodecenyl acetate	present	LOTUS
3,4-Dihydroxybenzaldehyde	present	LOTUS
4-[(4-Hydroxyphenyl)methyl]-3-methoxy-5-[2-(3-methoxyphenyl)ethyl]phenol	present	LOTUS
4-Ethoxymethylphenol	present	LOTUS
4-Hydroxybenzaldehyde	present	LOTUS
4-Hydroxybenzyl Alcohol	present	LOTUS
4-Methoxy-9,10-Dihydrophenanthrene-2,7-Diol	present	LOTUS
5-(2-(3-Hydroxy-5-methoxyphenyl)ethyl)-2-methoxyphenol	present	LOTUS
5-Hydroxy-2,2-dimethyl-7-(2-phenylethyl)chromene-6-carboxylic acid	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbophyllum wendlandianum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY508463.1 ↗248 bp

ACGT

AGCGTTGCGTCGCTCCGCGCCACCCCGGACCCGCCGATGGGCGTGCCGGGATGTGCTCGGATGCGGAGAATGGCCCGCCGTGCTCATCGG …

Bulbophyllum wendlandianum isolate TH01_LK008 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor3

Museum / vouchered4

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	1

1 institutions · 1 of 4 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Bulbophyllum wendlandianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)