Bulbophyllum wangkaense — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Bulbophyllum

At a glance

Occurrence records0

Data sources4

Biological traits6

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Bulbophyllum wangkaense's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

DNA & barcodingNCBIsequences

01Narrative

Single bulbophyllum wangkaense pseudobulb. Bulbophyllum wangkaense is a species of orchid in the genus Bulbophyllum. Bulbophyllum wangkaense in full bloom. Found only in Thailand at elevations around 200 to 300 meters as a miniature to small sized, hot growing epiphyte with [4 cm] between each conical pseudobulb carrying a single, elliptic, minutely retuse apically leaf that blooms on an erect to arching 2 to 4" [5 to 10 cm] long, many flowered inflorescence that is sheathed in the lower half.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbophyllum wangkaense has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMG253854.1 ↗676 bp

ACGT

CATTGTCGAGACCGAAATACTATCGAGCGATTCGGAGAACCGGTGAAAACCCGCGACGGCAGCTGCCGTGCGCGATAGCCATCCCAGTCG …

Bulbophyllum wangkaense internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode