Bulbophyllum vaginatum

(Lindl.) Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Bulbophyllum

At a glance

Occurrence records104

Data sources10

Biological traits6

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Bulbophyllum vaginatum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionLOTUS30 compounds

Occurrence & distributionGBIF104 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Bulbophyllum vaginatum is a species of orchid. Bulbophyllum vaginatum contains the two phenanthrenes 4,9-dimethoxyphenanthrene-2,5-diol and 4,6-dimethoxyphenanthrene-2,3,7-triol, and the two dihydrophenanthrenes 4-methoxy-9,10-dihydrophenanthrene-2,3,7-triol and 4,6-dimethoxy-9,10-dihydrophenanthrene-2,3,7-triol.Phenanthrenes, dihydrophenanthrenes and bibenzyls from the orchid Bulbophyllum vaginatum. Leong Y-W, KAng C-C, Harrison LJ and Powell AD, Phytochemistry, 1997, vol. 44, no 1, pages 157-165,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

03Chemical composition30 compounds

Compounds documented for Bulbophyllum vaginatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenanthrenes19

Cinnamic acids and derivatives3

Monomeric stilbenes3

Furofuranoid lignans1

Simple phenolic acids1

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Syringaresinol	present	LOTUS
(2S,3R)-2-(4-hydroxy-3,5-dimethoxyphenyl)-3-(hydroxymethyl)-9-methoxy-2,3,6,7-tetrahydronaphtho[2,1-g][1]benzofuran-5,11-diol	present	LOTUS
2,5-Dihydroxy-4,9-dimethoxyphenanthrene	present	LOTUS
2,7-Dihydroxy-4,6-dimethoxyphenanthrene	present	LOTUS
2,7-Phenanthrenediol, 3,4,6-trimethoxy-	present	LOTUS
2,7-Phenanthrenediol, 9,10-dihydro-3,4,6-trimethoxy-	present	LOTUS
3',4-Dihydroxy-3,5'-dimethoxybibenzyl	present	LOTUS
3,5-Dimethoxy-9,10-dihydrophenanthrene-2,7-diol	present	LOTUS
3,7-Dihydroxy-2,4-dimethoxyphenanthrene	present	LOTUS
4,6-Dimethoxy-1-(2,3,7-trihydroxy-4,6-dimethoxyphenanthren-1-yl)phenanthrene-2,3,7-triol	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbophyllum vaginatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON009214.1 ↗719 bp

ACGT

GCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAG …

Bulbophyllum vaginatum voucher T. Pingyot & N. Thawara 734 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Bulbophyllum vaginatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–402n range38median38mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 383×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2

CCDB · book-ipcn67-71 — DAKER, M.G. 1970. The chromosomes of orchids: IV Bulbophyllinae schltr. Kew Bull. 24: 179-184.

CCDB · book-indian_vol2 — Daker, M.G. 1970

CCDB · book-indian_vol2 — Mehra, P.N. & Vij, S.P. 1970

2n 401×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Vij, S.P. & Mehra, P.N. 1976

n 191×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MEHRA, P.N., & S.P. VIJ. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type104 records

Wild obs. + sensor67

Museum / vouchered37

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 24≤1 km 16≤10 km 4>10 km 4

48 georeferenced · 19 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	6
Philadelphia, US	3
Saint Louis, US	1

3 institutions · 10 of 37 vouchered records shown · 27 without an institution code

09Environmental DNA2 detections

Where the DNA of Bulbophyllum vaginatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)