Bulbophyllum retusiusculum

Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Bulbophyllum

At a glance

Occurrence records328

Data sources11

Biological traits10

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Bulbophyllum retusiusculum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility328 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS27 compounds

Occurrence & distributionGBIF328 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Bulbophyllum retusiusculum is a species of orchid in the genus Bulbophyllum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte or lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max2 600 m

Elevation min100 m

Epiphyteobligatory

Growth formherb

Woodinessnon-woody

03Chemical composition27 compounds

Compounds documented for Bulbophyllum retusiusculum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenanthrenes7

Monomeric stilbenes4

Minor lignans3

Cinnamic acids and derivatives2

Flavones1

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(2E)-3-(3,4-dimethoxyphenyl)prop-2-enal	present	LOTUS
3,3'-Dihydroxy-4,5-methylenedioxybibenzyl	present	LOTUS
3-(4-Hydroxy-5-methoxycyclohexa-2,4-dien-1-yl)prop-2-enyl 3-(4-hydroxycyclohexa-2,4-dien-1-yl)prop-2-enoate	present	LOTUS
4,7-Dihydroxy-2,3-methylenedioxy-9,10-dihydro-phenanthrene	present	LOTUS
4-Coumaric acid	present	LOTUS
4-Methoxy-6-[2-(3-methoxyphenyl)ethyl]-1,3-benzodioxole	present	LOTUS
6-[2-(3-Methoxyphenyl)ethyl]-1,3-benzodioxol-4-ol	present	LOTUS
Batatasin Iii	present	LOTUS
Benzenepropanoic acid, 4-hydroxy-, methyl ester	present	LOTUS
Dihydroconiferyl alcohol	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbophyllum retusiusculum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK164500.1 ↗717 bp

ACGT

GCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAG …

Bulbophyllum retusiusculum voucher S.Suddee5031 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Bulbophyllum retusiusculum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–382n range38median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · book-indian_vol2 · CCDB · eflora

CCDB · book-indian_vol2 — Mehra, P.N. & Sehgal, R.N. 1980

CCDB · eflora

n 191×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Mehra, P. N. & R. N. Sehgal. 1980. In IOPB chromosome number reports LXVII. Taxon 29: 348–350.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type328 records

Wild obs. + sensor141

Museum / vouchered186

Cultivated / captive1

Range

Area of Occupancy AOO748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 32≤1 km 9≤10 km 8>10 km 51

100 georeferenced · 41 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence186

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	52
Kunming, CN	42
Guangzhou, CN	24
Saint Louis, US	18
Chengdu, CN	12
Taipei, TW	10
Taipei, TW	6
Taipei, TW	3
South Kensington, GB	3
Edinburgh, GB	3
Bronx, US	2
Yangling, CN	2
Xining, CN	2
Moscow State Universitylocation not on record	1

14 institutions · 180 of 186 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Bulbophyllum retusiusculum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)