Bulbophyllum cylindraceum

Wall. ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Bulbophyllum

At a glance

Occurrence records29

Data sources9

Biological traits8

DNA specimens1

eDNA detections0

Sources9 archives

Databases and archives Bulbophyllum cylindraceum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF29 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Bulbophyllum cylindraceum is a species of orchid in the genus Bulbophyllum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatesubtropical

Climberself-supporting

Elevation max1 800 m

Elevation min1 800 m

Epiphyteobligatory

Growth formepiphyte

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbophyllum cylindraceum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP178153.1 ↗653 bpIndia · 2022

ACGT

CCGAATATGCTATCGAGCGATTCTGAATAACATGTGAAAATATGCGACGGCAGTTGCTGTGCGCAATAGCCATCCGAGTCGCTGCCTCGA …

Bulbophyllum cylindraceum voucher SD/NEHU/BC internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Bulbophyllum cylindraceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–422n range39median38mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 383×CCDB · ipcn-api-dl · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Lim, K. Y. & K. Jones. 1982. The chromosomes of orchids VI. Bulbophyllum. Kew Bull. 37: 217–219.

CCDB · ipcn-api-dl — Burg, W. J. V. & F. M. V. Laan. 1980. Notes on African Orchids. Belmontia. 11: 23–36.

CCDB · book-indian_vol2 — Vij, S.P. & Mehra, P.N. 1976; Mehra, P.N. & Sehgal, R.N. 1980

2n 422×CCDB · ipcn-api-dl · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Biswas, B. K. 1980b. In IOPB chromosome number reports LXVI. Taxon 29: 169.

CCDB · book-indian_vol2 — Biswas, B.K. 1980c '

2n 401×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Mehra, P.N. & Vij, S.P. 1970

n 191×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Biswas, B. K. 1980b. In IOPB chromosome number reports LXVI. Taxon 29: 169.

n 201×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MEHRA, P.N., & S.P. VIJ. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type29 records

Wild obs. + sensor5

Museum / vouchered23

Other1

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 4 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	7
Kunming, CN	7
Yangling, CN	2
South Kensington, GB	2
Edinburgh, GB	2
Bronx, US	1
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	1

7 institutions · 22 of 23 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)