Bulbophyllum corolliferum

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Bulbophyllum

At a glance

Occurrence records15

Data sources8

Biological traits6

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Bulbophyllum corolliferum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Bulbophyllum corolliferum is a species of orchid in the genus Bulbophyllum native to Thailand, Borneo, Malaya, Sumatra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbophyllum corolliferum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences9

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG253855.1 ↗651 bp

ACGT

CATTGTCGAGACCGAAGTACCATCGAGCGATTCGGAGAACCGGTAAAAATCAGCGCCGGCACTTGCCGTGCGCAATAGCCATCCCGGTCA …

Bulbophyllum corolliferum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4rbcL2rbcLaITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor8

Museum / vouchered7

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 1≤1 km 2>10 km 4

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	1

1 institutions · 1 of 7 vouchered records shown · 6 without an institution code

09Environmental DNA3 detections

Where the DNA of Bulbophyllum corolliferum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.