Bulbophyllum cheiri — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Bulbophyllum

At a glance

Occurrence records2

Data sources7

Biological traits7

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Bulbophyllum cheiri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF2 records

DNA & barcodingNCBIsequences

01Narrative

Bulbophyllum cheiri is a species of orchid in the genus Bulbophyllum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte or lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

03Chemical composition6 compounds

Compounds documented for Bulbophyllum cheiri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives6

Documented compounds6 total

Compound	Amount	Source
2-Allyl-4,5-Dimethoxyphenol	present	LOTUS
3-(3,4-Dimethoxyphenyl)prop-2-enyl acetate	present	LOTUS
Eugenol	present	LOTUS
gamma-Asarone	present	LOTUS
Methyl isoeugenol	present	LOTUS
Methyleugenol	present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bulbophyllum cheiri has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC487563.1 ↗677 bpMalaysia · 2013

ACGT

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAATACAATCGAGCGATTCAGAGAACCAGTGAAAATCAGCGACGGCA …

Bulbophyllum cheiri genes for SSU rRNA, ITS1, 5.8S rRNA, ITS2, partial and complete sequence, collection_date: 2013-04-28

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered1

Other1

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1