Bufonaria rana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Bursidae/Bufonaria

At a glance

Occurrence records1 856

Data sources9

Biological traits6

DNA specimens20

eDNA detections20

Sources9 archives

Databases and archives Bufonaria rana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 000 records↗

OBISOcean Biodiversity Information System856 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 856 records

Environmental DNA1 datasets · 4 countries20 detections

DNA & barcodingBOLD20 specimens

01Narrative

Bufonaria rana is a species of sea snail, a marine gastropod mollusk in the family Bursidae, the frog shells.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length9 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max166 m

Depth min25 m

Vulnerability10

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bufonaria rana has left across the world's sequence archives.

At a glance

DNA specimens20

BINs4

Marker genes2

eDNA detections20

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P616 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 88 variable positions, in barcode order

13Gmostly conserved

28Cmostly conserved

37Amostly conserved

43Tmostly conserved

50Tmostly conserved

67Amostly conserved

68Tmostly conserved

70Amostly conserved

112Tmostly conserved

124Amostly conserved

139Gmostly conserved

142Cmostly conserved

151Cmostly conserved

154Amostly conserved

166Amostly conserved

170Cmostly conserved

175Gvariable

187Amostly conserved

199Cmostly conserved

200Tmostly conserved

208Tmostly conserved

211Gmostly conserved

214Gmostly conserved

220Amostly conserved

221Cmostly conserved

223Gmostly conserved

247Amostly conserved

262Tmostly conserved

265Amostly conserved

271Gmostly conserved

283Amostly conserved

307Amostly conserved

316Tmostly conserved

317Cmostly conserved

319Amostly conserved

325Tmostly conserved

328Tmostly conserved

331Gmostly conserved

343Tmostly conserved

346Gmostly conserved

349Cmostly conserved

361Gmostly conserved

424Amostly conserved

433Amostly conserved

442Amostly conserved

448Amostly conserved

451Tmostly conserved

452Tmostly conserved

458Cmostly conserved

478Amostly conserved

484Amostly conserved

493Amostly conserved

496Cmostly conserved

499Cmostly conserved

506Tvariable

508Gmostly conserved

511Amostly conserved

520Tmostly conserved

526Tmostly conserved

538Tmostly conserved

559Tmostly conserved

562Amostly conserved

565Tmostly conserved

568Tmostly conserved

571Tmostly conserved

574Tmostly conserved

579Cmostly conserved

580Amostly conserved

582Gmostly conserved

583Amostly conserved

585Gmostly conserved

586Tmostly conserved

588Gmostly conserved

589Tmostly conserved

590Gmostly conserved

591Amostly conserved

594Cmostly conserved

595Tmostly conserved

596Amostly conserved

597Tmostly conserved

600Tmostly conserved

601Amostly conserved

602Tmostly conserved

603Amostly conserved

604Tmostly conserved

605Cmostly conserved

610Cmostly conserved

616Tmostly conserved

AACTGCTTTAAGGTTATTAATTCGAGCCGAATTAGGACAACCTGGAGCTTTATTAGGTGATGATCAATTATATAATGTTATTGTAACTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes4

BINs4

Most divergent pair8.3%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bufonaria crumenasame genus9.7%Bursina ignobilissame family9.9%Bursina gnorimasame family10.1%Bursa lamarckiisame family10.2%Tritonoranella latitudosame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_054277 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6ND1ND6CYTBND4LND4ND5COX3ND3ND212S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 856 records

Wild obs. + sensor715

Museum / vouchered1 091

Cultivated / captive47

Fossil1

Other2

Range

Area of Occupancy AOO3 264 km²

Depth

0–200 m sunlit210

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 31.6 m · max 165.5 m · 210 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 30≤1 km 186≤10 km 4>10 km 5

225 georeferenced · 490 without coordinates

Open the mapobservation + sensor715

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 10≤1 km 421≤10 km 252>10 km 31

714 georeferenced · 377 without coordinates

Open the institutions mapphysical evidence1 091

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 46

46 georeferenced · 1 without coordinates

Open the mapnot free-living47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	220
Natick, US	94
Museum and Art Gallery of the Northern Territorylocation not on record	64
Philadelphia, US	59
DEWlocation not on record	37
Santa Barbara Museum of Natural Historylocation not on record	33
Museums Victorialocation not on record	20
Western Australian Museumlocation not on record	16
Natural History Museum Rotterdamlocation not on record	13
Cambridge, US	11
Washington, US	10
QVMAGlocation not on record	9
Denver, US	7
Universidad del Valle (UniValle)location not on record	6
South Kensington, GB	4
Champaign, US	4
Provincia di Livornolocation not on record	3
Chongqing Museumlocation not on record	3
Mutare Museumlocation not on record	3
Delaware Museum of Nature and Sciencelocation not on record	3
Paris, FR	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Auckland, NZ	2
Los Angeles, US	2
NTNU-VMlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Paleontological Research Institutionlocation not on record	2
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Tomioka, JP	1
Salzburg, AT	1
Akita Prefectural Museumlocation not on record	1
Parthenon Tama History Museumlocation not on record	1
Bando, JP	1
Wakayama Prefectural Museum of Natural Historylocation not on record	1
Brussels, BE	1

35 institutions · 642 of 1 091 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA20 detections

Where the DNA of Bufonaria rana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–26.7

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 15.7–28.8

Min temp (night)3.10 °C 3.10–25.8

Precipitation13.8 mm/mo 12.6–195

Air humidity45.7 % 45.7–64.6

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa 827–1,266

Wind speed4.50 m/s

Cloud cover24.1 % 24.1–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Bufonaria rana

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Record type1 856 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 856 records