Bruchus rufimanus

Boheman, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Bruchus

At a glance

Occurrence records2 832

Data sources9

Biological traits2

DNA specimens39

eDNA detections14

Sources9 archives

Databases and archives Bruchus rufimanus's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 832 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 832 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD39 specimens

Genome at a glanceGoaT · TreeOfSex2n = 38

01Narrative

Beans, peas, and bean pod with holes drilled by Bruchus rufimanus Bruchus rufimanus, commonly known as the broadbean weevil, broadbean beetle, or broadbean seed beetle is a leaf beetle which inhabits crops and fields, as well as some homes. It is a pest of faba beans (Vicia faba L.). The adult beetles feed on pollen, while their larvae tunnel in seeds destroying crops and moving on to new ones once they dry out. The adult beetle, being one of the biggest of its genus, ranges from 3 to 5 mm in length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bruchus rufimanus has left across the world's sequence archives.

At a glance

DNA specimens39

BINs2

Marker genes2

eDNA detections14

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 104 variable positions, in barcode order

4Amostly conserved

10Cmostly conserved

16Tmostly conserved

22Amostly conserved

32Gmostly conserved

34Tmostly conserved

37Amostly conserved

39Cmostly conserved

40Tmostly conserved

41Gmostly conserved

43Gmostly conserved

44Amostly conserved

46Tmostly conserved

58Amostly conserved

59Cmostly conserved

67Gmostly conserved

74Tmostly conserved

76Amostly conserved

82Tmostly conserved

85Amostly conserved

88Tmostly conserved

90Cmostly conserved

91Tmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Cmostly conserved

98Gmostly conserved

99Gmostly conserved

100Amostly conserved

106Cmostly conserved

124Cmostly conserved

127Amostly conserved

133Cmostly conserved

160Amostly conserved

163Tmostly conserved

166Amostly conserved

170Avariable

178Tmostly conserved

181Gmostly conserved

199Amostly conserved

202Amostly conserved

205Cmostly conserved

208Amostly conserved

217Amostly conserved

220Tmostly conserved

223Cmostly conserved

232Amostly conserved

247Tmostly conserved

278Cmostly conserved

280Tmostly conserved

295Gmostly conserved

301Cmostly conserved

302Cmostly conserved

304Amostly conserved

307Amostly conserved

313Amostly conserved

316Gmostly conserved

319Amostly conserved

322Amostly conserved

334Amostly conserved

340Cmostly conserved

343Cmostly conserved

355Tmostly conserved

364Cmostly conserved

367Tmostly conserved

379Gmostly conserved

382Amostly conserved

400Gmostly conserved

412Tmostly conserved

415Gmostly conserved

424Tmostly conserved

428Cmostly conserved

433Amostly conserved

436Amostly conserved

451Amostly conserved

454Amostly conserved

466Gmostly conserved

469Gmostly conserved

474Gmostly conserved

499Tmostly conserved

508Tmostly conserved

514Amostly conserved

526Amostly conserved

535Cmostly conserved

538Cmostly conserved

541Cmostly conserved

547Tmostly conserved

548Cmostly conserved

553Tmostly conserved

559Amostly conserved

565Amostly conserved

568Tmostly conserved

574Amostly conserved

578Tmostly conserved

589Cmostly conserved

596Cmostly conserved

604Amostly conserved

607Amostly conserved

610Tmostly conserved

631Tmostly conserved

634Cmostly conserved

652Tmostly conserved

TACACTTTACTTTATTTTTGGAGCTTGAGCTGGTATAGCTGGGACTTCTCTTAGAATACTAATTCGGGCAGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes5

BINs2

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bruchus atomariussame genus5.3%Bruchus viciaesame genus9.2%Bruchus affinissame genus9.4%Bruchus rufipessame genus9.6%Bruchus luteicornissame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Bruchus rufimanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidy2× diploid · measured

Chromosome records38–382n range38median38mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 373×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

2n 383×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type2 832 records

Wild obs. + sensor2 338

Museum / vouchered421

Fossil61

Other12

Range

Area of Occupancy AOO6 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 979≤1 km 871≤10 km 373>10 km 8

2 231 georeferenced · 107 without coordinates

Open the mapobservation + sensor2 338

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 76≤1 km 67≤10 km 107>10 km 6

256 georeferenced · 165 without coordinates

Open the institutions mapphysical evidence421

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sam Noble Oklahoma Museum of Natural Historylocation not on record	74
SLU Artdatabankenlocation not on record	50
Tartu, EE	26
Natural History Museum Rotterdamlocation not on record	21
South Kensington, GB	12
ZSMlocation not on record	11
NTNU-VMlocation not on record	10
Uniwersytet Wrocławskilocation not on record	10
NCMGlocation not on record	8
Helsinki, FI	7
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	7
Tallinn, EE	6
Provincia di Livornolocation not on record	5
MZLUlocation not on record	5
Cape Town, ZA	5
neflocation not on record	3
Natural History Museum, Londonlocation not on record	3
Winterthur, CH	3
CBDClocation not on record	2
Chiba, JP	2
Sagamihara, JP	2
Philadelphia, US	2
Ugentlocation not on record	2
Uniwersytet Łódzkilocation not on record	2
NTNU University Museum, Department of Natural Historylocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
NMOKlocation not on record	2
BioFokuslocation not on record	2
Yamaguchi-shi, JP	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
NHMOlocation not on record	1
IFR-DNFlocation not on record	1

32 institutions · 290 of 421 vouchered records shown · 128 without an institution code

09Environmental DNA14 detections

Where the DNA of Bruchus rufimanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–16.4

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 15.7–19.2

Min temp (night)3.10 °C 3.10–13.5

Precipitation13.8 mm/mo 13.8–110

Air humidity45.7 % 45.7–60.5

Moisture balance-95.2 mm/mo -95.2–17.1

Vapour deficit827 Pa 739–827

Wind speed4.50 m/s 2.80–4.50

Cloud cover24.1 % 24.1–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Bruchus rufimanus

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 832 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 832 records