Bromus secalinus
speciesAt a glance
Occurrence records27 922
Data sources12
Biological traits51
DNA specimens25
eDNA detections12
Sources12 archives
Databases and archives Bromus secalinus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility27 922 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics25 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources51 traits
Occurrence & distributionGBIF27 922 records
Environmental DNA1 datasets · 4 countries12 detections
DNA & barcodingBOLD · NCBI25 specimens
Genome at a glanceCCDB · GoaT11 Gbp
01Narrative
Le brome faux-seigle, ou brome seigle, est une plante herbacée annuelle de la famille des Poacées, autrefois assez commune mais maintenant en très forte régression, que l'on rencontre surtout dans les champs de céréales. C'est une "mauvaise herbe".
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology15
Leaf length150 mm
Leaf mass103 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 1 914 mm² · GIFT: 1 914 mm²
Leaf width5 mm
Plant height0.76 m
⚠ sources differ — GIFT: 0.76 m · AusTraits: 1 m · LEDA: 0.87 m · TRY: 0.823 m
Plant height generative1.2 m
Plant height max1 m
Plant height min0.4 m
Seed length7.9 mm
Seed mass9.92 mg
⚠ sources differ — TRY: 9.92 mg · LEDA: 9.92 mg · GIFT: 10.75 mg
Seed mass max12.1 mg
Seed mass min10.53 mg
Seed volume11 mm³
Seed volume max11 mm³
Seed volume min11 mm³
Life cycle & reproduction15
Deciduousnessevergreen
Dispersal typeanimal
Flowering endJul
Flowering startJun
Flowering timennnnnnnnyyyn
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: summer annuals · GIFT: annual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number730
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation mean500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Graminoid
Habitat GIFTcrop fields
Leaf compoundnesssimple
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)290 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)19.18 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding25 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bromus secalinus has left across the world's sequence archives.
At a glance
DNA specimens25
Marker genes6
GenBank sequences10
eDNA detections12
Countries6
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGTCGAGGGCACGCCTGCTTGGGCGTCACGCCAA …
Bromus secalinus voucher CCDB-18344-H4 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL1★rbcLa★ITS6★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Bromus secalinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size11 012 280 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Bromus secalinus11.01 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–282n range28median28mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2821×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4598
CCDB · fl-europaea — LOve & LbVe, 1944
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Semenov, V. I. 1986. Vnutrikhromosomnaja topografija geterokhromatina u zlakovykh. Bjulleten' Glavnogo Botanic|5eskogo Sada 140: 68–73.
CCDB · ipcn-api-dl — Shi, Y., J. Draper & C. Stace. 1993. Ribosomal DNA variation and its phylogenetic implication in the genus Brachypodium (Poaceae). Pl. Syst. Evol. 188: 125–138.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · book-ipcn75-78 — Hindakova 1978
CCDB · book-ipcn75-78 — Skalinska et al. 1978
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · eflora
CCDB · book-atlas-flowering-plants — Knowles 1944
CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.
CCDB · Cave1957 — Schulz-Schaeff. & Mark.
CCDB · CromoCat 2015 — Shi, Y. , J. Draper & C. Stace. (1993). Ribosomal DNA variation and its phylogenetic implication in the genus Brachypodium (Poaceae). Pl. Syst. Evol. 188:125-138
CCDB · CromoCat 2015 — Lloret i sabaté, F. (1990). Estudis citogenètics, fitoecològics, citogeogràfics i evolutius en les seccions genea Dumort. I Bormus del gènere Bromus L. 332-344
2n 141×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Nielsen 1939
n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Lloret i sabaté, F. (1990). Estudis citogenètics, fitoecològics, citogeogràfics i evolutius en les seccions genea Dumort. I Bormus del gènere Bromus L. 332-344
n 281×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type27 922 records
Wild obs. + sensor20 984
Museum / vouchered6 805
Cultivated / captive21
Other112
Origin
Native75
Introduced1 368
Range
Area of Occupancy AOO60 116 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy27% within 1 km
≤100 m 2 454≤1 km 2 519≤10 km 13 367>10 km 385
18 725 georeferenced · 2 259 without coordinates
Open the mapobservation + sensor20 984
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy32% within 1 km
≤100 m 389≤1 km 995≤10 km 2 121>10 km 876
4 381 georeferenced · 2 424 without coordinates
Open the institutions mapphysical evidence6 805
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy14% within 1 km
≤1 km 2≤10 km 1>10 km 11
14 georeferenced · 7 without coordinates
Open the mapnot free-living21
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions152 of 255 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 905 |
| Helsinki, FI | 616 |
| LDlocation not on record | 389 |
| Uppsala, SE | 238 |
| Moscow State Universitylocation not on record | 195 |
| SLU Artdatabankenlocation not on record | 172 |
| Olocation not on record | 162 |
| MeiseBGlocation not on record | 157 |
| Tartu, EE | 148 |
| Wuzhou, CN | 133 |
| Kuopio, FI | 128 |
| Turku, FI | 119 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 119 |
| BRNUlocation not on record | 115 |
| Oulu, FI | 108 |
| BFLlocation not on record | 103 |
| Uniwersytet Jagiellońskilocation not on record | 92 |
| Philadelphia, US | 79 |
| Bloomington, US | 67 |
| Philadelphia, US | 67 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 65 |
| Bronx, US | 62 |
| Bern, CH | 61 |
| International Salmonella Centre (W.H.O.)location not on record | 59 |
| DBF-NHMDlocation not on record | 58 |
| Trondheim, NO | 58 |
| Oskarshamn, SE | 56 |
| Chongqing Museumlocation not on record | 54 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 54 |
| Görlitz, DE | 51 |
| BIO-UNIPIlocation not on record | 45 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 44 |
| Adam Mickiewicz University in Poznańlocation not on record | 39 |
| Bergen, NO | 39 |
| Tallinn, EE | 38 |
| Pullman, US | 34 |
| South Kensington, GB | 31 |
| Ann Arbor, US | 30 |
| New Haven, US | 30 |
| CJBGlocation not on record | 28 |
| Dresden, DE | 27 |
| TUR-Alocation not on record | 26 |
| Jyväskylä, FI | 25 |
| Brussel, BE | 24 |
| Burlington, US | 23 |
| Mlocation not on record | 23 |
| Uniwersytet Warszawskilocation not on record | 23 |
| Austin, US | 22 |
| Salzburg, AT | 22 |
| Saint Louis, US | 22 |
| Zürich, CH | 22 |
| Corvallis, US | 22 |
| Fort Worth, US | 22 |
| Nagano City, JP | 21 |
| UGentlocation not on record | 21 |
| PRClocation not on record | 17 |
| College Park, US | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Durango, MX | 17 |
| KMNlocation not on record | 16 |
| WTUlocation not on record | 16 |
| Staten Island, US | 14 |
| Provincia di Livornolocation not on record | 13 |
| John May Museum of Natural Historylocation not on record | 13 |
| University of New Hampshirelocation not on record | 13 |
| Odawara, JP | 12 |
| Sanda, JP | 12 |
| JP | 10 |
| Porrentruy, CH | 10 |
| Davis, US | 10 |
| Allentown, US | 10 |
| Pittsburg, US | 10 |
| Madison, US | 10 |
| Museo Entomologico de Leonlocation not on record | 9 |
| Mount Annan, AU | 9 |
| Wlocation not on record | 9 |
| Knoxville, US | 9 |
| Berlin, DE | 9 |
| Tampa, US | 9 |
| Logan, US | 9 |
| Kushiro City Museumlocation not on record | 8 |
| Frankfurt am Main | 8 |
| Claremont, US | 8 |
| Moscow, US | 8 |
| Fulda, DE | 7 |
| Tsukuba, JP | 7 |
| Auckland, NZ | 7 |
| Xiamen, CN | 7 |
| GJOlocation not on record | 6 |
| Mississippi State, US | 6 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 6 |
| Bozeman, US | 6 |
| GB | 6 |
| EL PASO, US | 6 |
| Riverside, US | 6 |
| University of Stellenboschlocation not on record | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| St. Paul, US | 6 |
| Québec, CA | 5 |
| Nijmegen, NL | 5 |
| Davenport, US | 5 |
| Karlsruhe, DE | 5 |
| Forssa, FI | 5 |
| Podgorica, ME | 5 |
| Columbia, US | 5 |
| Victoria, CA | 5 |
| Porvoo, FI | 5 |
| Akita Prefectural Museumlocation not on record | 5 |
| Frauenfeld, CH | 4 |
| BAYLUlocation not on record | 4 |
| Otaru, JP | 4 |
| FLADlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| IDElocation not on record | 4 |
| Tuscaloosa, US | 4 |
| SIHUlocation not on record | 4 |
| Dekalb, US | 4 |
| Toyama, JP | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Bando, JP | 3 |
| CASlocation not on record | 3 |
| Vancouver, CA | 3 |
| National Museum Waleslocation not on record | 3 |
| TROMlocation not on record | 3 |
| Bourges, FR | 3 |
| KIRMlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| BSBIlocation not on record | 3 |
| BDBClocation not on record | 3 |
| Chapel Hill, US | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| Tacoma, US | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Christchurch, NZ | 3 |
| AUT001location not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Jackson, US | 3 |
| Tilburg, NL | 3 |
| Zürich, CH | 3 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Ciudad Autónoma de Buenos Aires, AR | 3 |
| Taipei, TW | 3 |
| Bangkok, TH | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| Provo, US | 2 |
| Portland, US | 2 |
| US | 2 |
| Chicago, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Toronto, CA | 2 |
| Dhaka, BD | 2 |
| Norfolk, US | 2 |
| Missoula, US | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Chicago, US | 2 |
| Montréal, CA | 2 |
| Cheney, US | 2 |
| Sagamihara, JP | 2 |
| Fayetteville, US | 2 |
| H-AkrKGlocation not on record | 2 |
| Lausanne, CH | 2 |
| Barcelona, ES | 2 |
| Stephenville, US | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Université Lavallocation not on record | 2 |
| Tomioka, JP | 2 |
| Stockholm, SE | 2 |
| San Diego, US | 2 |
| Salvador, BR | 2 |
| BClocation not on record | 2 |
| Bend, US | 2 |
| Ashland, US | 2 |
| Shinshu Universitylocation not on record | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Beijing, CN | 2 |
| Millersville, US | 2 |
| 2 | |
| University of Alberta Museumslocation not on record | 2 |
| Paris, FR | 2 |
| Edmonton, CA | 2 |
| Saint John, CA | 1 |
| Santiago de Compostela, ES | 1 |
| Coimbra, PT | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Nishihara, JP | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Santa Barbara, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Henderson, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Springfield, US | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Kirksville, US | 1 |
| Morgantown, US | 1 |
| Williamsburg, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| València, ES | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Kew, GB | 1 |
| San Angelo, US | 1 |
| Chadron, US | 1 |
| Emporia, US | 1 |
| Osaka, JP | 1 |
| Denver, US | 1 |
| Montecillo, Texcoco, MX | 1 |
| NMBU:MINAlocation not on record | 1 |
| Durham, US | 1 |
| UChlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Whitehorse, CA | 1 |
| BOISlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Dipartimento di Scienze della Vita dell'Università degli Studi di Trieste | Department of Life Sciences of the University of Triestelocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Lubbock, US | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Irvine, US | 1 |
| Acadia Universitylocation not on record | 1 |
| Wellington, NZ | 1 |
| US | 1 |
| Fullerton, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| Arcata, US | 1 |
| San Isidro, AR | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| GAlocation not on record | 1 |
| US | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| US | 1 |
| Winterthur, CH | 1 |
| Chiba, JP | 1 |
| Kharazmi Universitylocation not on record | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| University of Bayreuthlocation not on record | 1 |
| Denton, US | 1 |
| Garðabær, IS | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Canberra, AU | 1 |
| Little Rock, US | 1 |
| KNFHClocation not on record | 1 |
255 institutions · 6 134 of 6 805 vouchered records shown · 560 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA12 detections
Where the DNA of Bromus secalinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found12
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 12 detections have coordinates
Open the map4 countries0
IGER glasshouse
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.5 °C 9.10–18.4
Seasonal swing summer↔winter14.3 °C
Max temp (day)18.6 °C 11.4–22.2
Min temp (night)12.6 °C 6.10–14.5
Precipitation85.2 mm/mo 69.5–179
Air humidity62.3 % 58.0–67.9
Moisture balance-14.2 mm/mo -53.5–141
Vapour deficit655 Pa 371–876
Wind speed4.00 m/s 2.50–6.20
Cloud cover47.7 % 38.9–50.8
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.