Bromus grossus

Desf. ex DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Bromus

At a glance

Occurrence records1 094

Data sources9

Biological traits27

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Bromus grossus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 094 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF1 094 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT13.6 Gbp

01Narrative

Bromus grossus, en français le Brome épais, est une espèce de plantes herbacées de la famille des Poaceae, typique des moissons d'épeautre.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Leaf mass9.91 mg

Leaf size308 mm²

Plant height0.2 m

⚠ sources differ — GIFT: 0.2 m · LEDA: 0.2 m · TRY: 0.225 m

Plant height generative0.483 m

Plant height max1 m

Plant height min0.5 m

Seed mass4.78 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Life formannual

Life spanannual

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formtherophyte

Seed number151

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)291 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)30.96 mm²/mg

Other traits1

Diaspore typefruit with appendage

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bromus grossus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM141053.1 ↗709 bpAustria · 1925

ACGT

CCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGA …

Bromus grossus voucher W:2015-0007797 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Bromus grossus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size13 594 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Bromus grossus13.59 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy4× tetraploid · measured

Chromosome records28–282n range28median28mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 285×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · eflora +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · fl-europaea — Toumay, 1968

CCDB · eflora

CCDB · book-atlas-flowering-plants — Cugnac & S. 1941

CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 094 records

Wild obs. + sensor693

Museum / vouchered401

Range

Area of Occupancy AOO2 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 8≤1 km 49≤10 km 405>10 km 7

469 georeferenced · 224 without coordinates

Open the mapobservation + sensor693

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 1≤1 km 65≤10 km 179>10 km 2

247 georeferenced · 154 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	104
MeiseBGlocation not on record	61
Zürich, CH	38
CJBGlocation not on record	32
Universität Basel, Herbariumlocation not on record	29
Bern, CH	17
Zürich, CH	12
Mlocation not on record	10
UNINE:NEUlocation not on record	10
Naturmuseum St. Gallenlocation not on record	9
Brussel, BE	8
Archäologie und Museum Baselland - Museum.BLlocation not on record	7
Frankfurt am Main	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
Naturhistorische Gesellschaft Nürnberg e.V.location not on record	3
H-AkrKGlocation not on record	3
John May Museum of Natural Historylocation not on record	3
Glarus, CH	2
Dresden, DE	2
Berlin, DE	1
BFLlocation not on record	1
Fribourg, CH	1
Wlocation not on record	1
Frauenfeld, CH	1
ER Kochlocation not on record	1
Conservatoire botanique national du Bassin parisienlocation not on record	1
Winterthur, CH	1

28 institutions · 369 of 401 vouchered records shown · 32 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Bromus grossus

At a glance

Sources9 archives

Size & morphology7

Life cycle & reproduction9

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 094 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 28 geolocated

Record type1 094 records